Skip to main content

Advertisement

Table 2 VNTR primer sequences and concentrations

From: Tandem repeat regions within the Burkholderia pseudomallei genome and their application for high resolution genotyping

Locus Name Primer Sequence PCR Mix Final [Primer] uM Dye
933 k F: atggtggcggccgtcggcgaaaacc 1.1 0.20 * Fam
  R: gctcgaatgggtgtacgaagggccacgctgattc   0.2  
2065 k F: gggggacccggcgcacgacagg 1.1 0.20** Vic
  R: cggcgcgttgggacgatcggcttgat   0.2  
2971 k F: gcgcaagcgcgactcggccactcg 1.2 0.1 Pet
  R: gtcgccgggcgcggggctacatcttctta   0.1  
3145 k F: ggcaggcaccgccggcatggaagc 1.2 0.2 Ned
  R: gcgtcgcgcgtatcgatccgactgattgtacc   0.2  
2666 k b F: gctgcaagtccgccttcacgcgcatcag 2 0.13 Ned
  R: gcggcggccggctcgagttggact   0.13  
3671 k a F: gcagcggctttggatcgcccgggttct 2 0.10* Pet
  R: gggccggggcgcggaagtcgaaagtt   0.1  
2115 k a F: ggtgcgtgctggtgtcgctgctgtgctatctgt 2 0.1 Vic
  R: ggggaaggcgccggattgcccgagtt   0.1  
2341 k F: ggcttcgcacccgccccatttcagc 2 0.10** Fam
  R: gcaccgggcgcggcgcactcg   0.1  
1500 k F: cagagcgcggcgaggacgatcaaaaggag 2 0.10** Fam
  R: gccgcggctactggcgccaccattg   0.1  
3091 k F: aattcgtcggcagcgggcacggaagatg 3 0.20* Vic
  R: agcgggcacgcagcttgacggaacc   0.2  
3152 k c F: cggcgcggcgttcgtccggctactc 3 0.2 Pet
  R: acgaatgcggggcccgaggttgacgatagg   0.2  
3652 k F: gattcggacggtcggccccgggtatcaa 3 0.25 Ned
  R: gctggacgaaatccggggcgggacaaag   0.25  
3564 k F: ggccatgccgctgccgggttgagc 3 0.20* Fam
  R: cgcgggaagcgggttttgacgaagggtgtagttt   0.2  
20 k F: gcaccgcgagcgccgagcccgaac 4 0.20 * Ned
  R: gcgcccggcggccaaccctttgtcg   0.2  
857 k F: cgcgccggatacgccgtccaccag 4 0.2 Fam
  R: acgccggcgccgcaatggctgtc   0.2  
1690 k F: cgtttcccgtttgatgcatttgcgttccctttgaa 4 2 Pet
  R: catcgcggccgtcagaaaagttgagaaacctcgtc   2  
2445 k F: caggccgggccgtcgacgtgttcg 4 0.1 Vic
  R: atcggggagggagggcgacgaggtgaagg   0.1  
1367 k a F: ggcgctgccgtggccggacgac 5 0.3 Ned
  R: gccggcgaagcatcgaggcggtatg   0.3  
1764 k F: acccggtcggcacgctacggaactggttgtt 5 2 Pet
  R: cggcggtgaactggcttggcggacctc   2  
2815 k F: cgaggacgcggctcaggtcgatgattttcagg 5 0.1 Fam
  R: cggcgggcgggctttgcatgtcgt   0.1  
2170 k F: cgcatcggcgcaacgtcgtcatctcgt 6.1 0.10* Fam
  R: cggcgaccgcgcagggcagttga   0.1  
389 k F: gttacaagcgcgggtcggcaagaggctgaaa 6.1 0.10* Vic
  R: gccggtgttgaacgagtgggtggcgtaagc   0.1  
1788 k F: gcgcggcgagaacggcaagaacgaa 6.2 0.10* Pet
  R: gagcatcgggtgggcggcgcgtattgat   0.1  
1217 k a F: gcgagatgcgggcgtgtgcggtgtg 6.2 0.2** Ned
  R: gcggcggccgtgagcctgctgagaatc   0.2  
397 k F: cgcacgcgggcaggccgagacg 7 0.20** Fam
  R: gcggtcgcgcccttccacgcttcatc   0.2  
2050 k F: ccggcggccgcttcgtcgtctcg 7 0.2 Pet
  R: cgcgaagtcgatccgcaactgcctgctcac   0.2  
2862 k a F: gattcggcgcggtccgtaccagcttgttgc 7 0.3 Vic
  R: gcgcggggtatgtgacggggcagagc   0.3  
140 k a F: gcgcgcaccggccgcttcgactgacga 8 0.3 Fam
  R: gcatacggtcgcgccgggcgggtggtaggaag   0.3  
2356 k F: ccgctgatcggcgtgctgacggtgtt 8 0.2 Ned
  R: gctcggggcgctcggcgttctctg   0.2  
2518 k a F: caggcgcagttgtcgattgacgggtgtggac 8 0.2 Vic
  R: acggcgggatgtgcgcggtctgacg   0.2  
2124 k a F: ctgcgcgtgctgcccggcgtcac 9 0.2 Vic
  R: cgcgtggcggaatgcgcatgatagg   0.2  
1934 k c F: cgacgtgatccgcggctatctcgaagacg 9 0.2 Pet
  R: ccgacgcggcttgccagcttggatcgttag   0.2  
  1. * 50% unlabeled Forward primer
  2. ** 75% unlabeled Forward primer
  3. a Not recommended for globally diverse isolates
  4. b Not used in phylogenetic analysis due to < 80% amplification
  5. c Locus reported in Liu et al. 2006 [22]