Skip to main content

Table 1 Primers1 used for cloning of ap65-3 gene

From: Characterization of the Trichomonas vaginalis surface-associated AP65 and binding domain interacting with trichomonads and host cells

Clone Primer sequence for AP65-3 Plasmid
5' c1 Bgl II GGGGAGATCTGATGCTCGCATCTTCAGTCG pET-26b(+)
3' c1 Bgl II GGGGAGATCTGGCCAGCCGTGGTAGAGTG pET-26b(+)
5' c2 Bgl II GGGGAGATCTGATGACCCTCCTTCAGG pET-26b(+)
3' c2 Bgl II GGGGAGATCTGGCCAGCCGTGGTAGAGTG pET-26b(+)
5' c3 Bgl II GGGGAGATCTGGGGAGATTCCTCTTCACACA pET-26b(+)
3' c3 Bgl II GGGGAGATCTGGGAAGCAGTTGCAGCGCCAG pET-26b(+)
5' c4 Bgl II GGGGAGATCTAATCCTCGCCGACCCA pET-26b(+)
3' c4 Bgl II GGGGAGATCTACACCCTCAAGGACGGAG pET-26b(+)
5' c5 Bgl II GGGGAGATCTGATGGTCCATGCTGACCGTA pET-26b(+)
3' c5 Bgl II GGGGAGATCTAGGTCCTTGAGCTCTGTG pET-26b(+)
5' FL NdeI GTCCAGCATATGATGCTCGCATCTTCAGTCG pBS-ap65-HA
3' FL Asp718 GTCCACGGTACCATAGTAGAGTTGCTCGTATTC pBS-ap65-HA
  1. 1 These primers were used for the cloning of overlapping fragments and full-length of the ap65-3 gene in the pET-26b(+) vector (Novagen EMD Chemicals Inc) in E. coli and pBS-HA vector in T. vaginalis [16, 23].