Skip to main content

Table 4 Overview of the primer sequences and PCR conditions as used in this study

From: Quantitative determination by real-time PCR of four vaginal Lactobacillus species, Gardnerella vaginalis and Atopobium vaginae indicates an inverse relationship between L. gasseri and L. iners

Specificity Name Primer sequence (5'-3') 16S rDNA positiona (5'-3') Cycling conditions Reference
A. vaginae ATOVAGRT3Fw GGTGAAGCAGTGGAAACACT 1006–1025 10' 95°C, (15" 95°C, 20" 62°C, 40" 72°C) × 40 This study
  ATOVAGRT3Rev ATTCGCTTCTGCTCGCGCA 1282–1265   
G. vaginalis F-GV1 TTACTGGTGTATCACTGTAAGG 16S-23S spacer 10' 95°C, (45" 94°C, 45" 55°C, 45" 72°C) × 50 [27]
  R-GV3 CCGTCACAGGCTGAACAGT 16S-23S spacer   
L. crispatus LcrisF AGCGAGCGGAACTAACAGATTTAC 65–89 10' 95°C, (15" 95°C, 1' 60°C) × 40 [26]
  LcrisR AGCTGATCATGCGATCTGCTT 205–185   
L. gasseri LactoF TGGAAACAGRTGCTAATACCG 157–177 10' 95°C, (15" 95°C, 1' 60°C) × 40 [26]
  LgassR CAGTTACTACCTCTATCTTTCTTCACTAC 470–442   
L. iners InersFw GTCTGCCTTGAAGATCGG 70–85 10' 95°C, (1' 95°C, 1' 55°C, 1' 65°C) × 35 This study
  InersRev ACAGTTGATAGGCATCATC 228–210   
L. jensenii LABJENTR2Fw CCTTAAGTCTGGGATACCATT 117–137 10' 95°C, (15" 95°C, 10" 54°C, 30" 72°C) × 40 This study
  LABJENRT2Rev ACGCCGCCTTTTAAACTTCTT 207–187   
  1. aRelative to the position in the Escherichia coli 16S rDNA sequence.