Skip to main content

Table 2 Bacterial strains, plasmids and oligonucleotide primers used in this work

From: Genetic characterization of psp encoding the DING protein in Pseudomonas fluorescens SBW25

Strain, plasmid or primer Relevant properties Source/reference
P. fluorescens   
SBW25 Wild type strain isolated from sugar beet [10]
SBW25-Sm Spontaneous Smr derivative of SBW25 [20]
SBW25ΔdapB DAP/lysine auxotroph of SBW25 [20]
PIL082 The hxcR-'dapB'lacZ IVET fusion strain of SBW25ΔdapB, Tcr This work
PIL082-1 ΔdapB DUP(hxcS-psp)::pIVETD, the psp-'dapB'lacZ IVET fusion strain, Tcr This work
SBW25-lacZ SBW25 marked with 'lacZ in a phage locus [28]
PBR826 Δpsp or Δpflu2427, SBW25 with a nonpolar deletion of psp, Tcs This work
PBR827 ΔpstC or Δpflu3317, SBW25 with a nonpolar deletion of pstC, Tcs This work
PBR828 ΔhxcR or Δpflu2424, SBW25 with a nonpolar deletion of hxcR, Tcs This work
PBR829 DUP(hxcS-psp)::pUIC3, the psp-'lacZ fusion strain of SBW25, Tcr This work
PBR830 DUP(pstS-pstC)::pUIC3, the pstC-'lacZ fusion strain of SBW25, Tcr This work
Plasmid   
pRK2013 Helper plasmid, Tra+, Kmr [34]
pUIC3 Integration vector with promoterless 'lacZ, ori R6K, Mob+, Tcr [21]
pIVETD DAP-based IVET vector, pUIC3 with promoterless 'dapB'lacZ, ori R6K, Tcr [20]
pIVETD-13 pIVETD containing 0.8 kb psp fragment fused to 'dapB'lacZ, ori R6K, Tcr This work
pUIC3-61 pUIC3 carrying psp-'lacZ fusion, ori R6K, Tcr This work
pUIC3-62 pUIC3 carrying pstC-'lacZ fusion, ori R6K, Tcr This work
pUIC3-41 pUIC3 containing 1.6 kb psp deletion fragment, ori R6K, Tcr This work
pUIC3-63 pUIC3 containing 1.6 kb pstC deletion fragment, ori R6K, Tcr This work
pUIC3-64 pUIC3 containing 1.9 kb hxcR deletion fragment, ori R6K, Tcr This work
Primera   
psp-1 GAAGATCT GTTGCGTGCCCTGGAAG  
psp-2 cagcatgcggatcc gttgacggaAGCGAGGGTCATGGATACCG  
psp-3 tccgtcaacggatcc gcatgctgCGGCAACACCAACGTCTGC  
psp-4 GAAGATCT GCTGCTGGAAATCCACGGT  
hxcR-1 GAGATCT GCGGTAATGGCCACCTATG  
hxcR-2 cagcatgcggatcc gttgacggaCGCTGCACCTCGCTGATCGA  
hxcR-3 tccgtcaacggatcc gcatgctgTCGACGACGATGTGCGCAGC  
hxcR-4 GAGATCT ATGCCAATTCAAACGCGCCA  
pstC-1 GAGATCT TCACCAAGCACCTGGCGG  
pstC-2 cagcatgcggatcc gttgacggaAGCCGTGCTTTTCCATGCCT  
pstC-3 tccgtcaacggatcc gcatgctgTCGCTGTTTGCACCGGCCAAC  
pstC-4 GAGATCT GCCGGTGGGCAAGACGATTTTC  
  1. a Restriction sites incorporated into the primers are underlined. Complementary sequence designed for the SOE-PCR is indicated by small letters.