Skip to main content

Table 2 Primers used in this study

From: Improved protocols for functional analysis in the pathogenic fungus Aspergillus flavus

Primer name Sequence* Purpose**
P0 TTGAAGTCATGGTGGAGGTG 1
P1 ATGTACTCCGTACTCGGTTG 1, 2
P2 TTATATTCTCCCTCGCCATActtggaccacacgagtcaag 1, 2
P3 cttgactcgtgtggtccaagTATGGCGAGGGAGAATATAA 1, 2
P4 gcggaggatatttcgttttcATAACAAGGCCTCGTATGTG 1, 2
P5 CACATACGAGGCCTTGTTATgaaaacgaaatatcctccgc 1, 2
P6 ACTACACCTTGGGGACTGTA 1, 2
  1. * Sequence in upper-case is homologous to A. flavus genome, and lower-case is homologous to pyr4 gene of N. crassa.
  2. ** Purpose 1: identifying transformants; purpose 2: constructing overlap PCR construct.