Skip to main content

Table 4 Oligonucleotides used in this study.

From: Identification of pathogenic Leptospira species by conventional or real-time PCR and sequencing of the DNA gyrase subunit B encoding gene

Assay Use Oligonucleotide Sequence (5'–3') Reference
gyrB – Conventional and real-time PCR. Amplification and sequencing 2For TGAGCCAAGAAGAAACAAGCTACA This study
   504Rev MATGGTTCCRCTTTCCGAAGA  
16s rRNA gene Amplification and sequencing FD1MOD AGAGTTTGATCYTGGYTYAG [25]
   13R AGGCCCGGGAACGTATTCAC [26]
  Sequencing 515F GTGCCAGCAGCCGCGGTAA [26]
   91e TCAAAGGAATTGACGGGGGC [26, 27]
   11e GAGGAAGGTGGGGATGACG [27]
   16s1RRB CTTTACGCCCARTRAWTCCG [28]
   907R CCGTCAATTCCTTTRAGTTT [29]
   342R CTGCTGCSYCCCGTAG [29]