Skip to main content

Table 2 Oligonucleotides utilized in this study

From: Functional characterization of a three-component regulatory system involved in quorum sensing-based regulation of peptide antibiotic production in Carnobacterium maltaromaticum

Primer Sequence
BRcbnKR-f 5'-TAAAAGCTTTTGAATTCTGATATACTC-3'
BRcbnKR-r 5'-TCTCATCTTGCTGCAGGACAAATG-3'
BRH239A-f 5'-AGGAAATTTAAGGCG GACTATGAGAATC-3'
BRH239A-r 5'-GAGATTCTCATAGTCCGC CTTAAATTTCC-3'
BRD62N-r 5'-TGATTTAAATCGATGTT TAAAAAGTAAATTC-3'
BRBsmFI-f 5'-GTTACTTTAGTATTGGGGACCG-3'
BRBsp-f 5'-GATACAAGGAACTTCTTCGAAAG-3'
BRBsp-r 5'-CTTTCGAAGAAGTTCCTTGTATC-3'
PcbnBM1-f 5'-CCGGGATCC TATGTCCTTTTGAAAAACCAAACTC-3'
PcbnBM1-r 5'-CCGGAATT CGTCTATACACTCCTTATAAAGTATTT3'
  1. Restriction sites introduced with the oligonucleotides are underlined. Mutated codons are shown in bold.