Skip to main content

Advertisement

Table 2 List of tandem repeat loci investigated

From: Evaluation and selection of tandem repeat loci for a Brucella MLVA typing assay

22 tandem repeats with a predicted different length in the 3 genomes:
vntra alias namea Chr % b upper primer lower primer b.suisc b.melc b.aborc nb of different allelesd min-max bpe HGDI f
BRU1938_8bp_371bp_9u Bruce01 or TR7 1 100 GGTCTGGGAAAACATGAAAAGC AGCCGATCCTGCAAAACATAAT 395 371 419 12 331–435 0.95
BRU1923_339bp_787bp_3u Bruce02 1 94 AACGCAGCATCACCAATGT CCCAGATGTTCGGCTATAGTATG 448 787 2143 6 448–1974 0.8
BRU1627_9bp_199bp_3u Bruce03 1 82 GGCTATTATTTCACCGGCAAGA TCTTGATTTCCTTGCGATACCA 208 199 217 4 154–217 0.48
BRU1543_8bp_152bp_2u Bruce04 or TR6** 1 100 CTGACGAAGGGAAGGCAATAAG CGATCTGGAGATTATCGGGAAG 184 152 160 8 152–208 0.87
BRU1365_8bp_185bp_3u Bruce05 1 84 AAGTATCAGGAAGGGCAGGTTC GGGAGTAGGGGAATAAGGGAAT 193 185 201 4 185–217 0.59
BRU1322_134bp_408bp_3u Bruce06* 1 94 ATGGGATGTGGTAGGGTAATCG GCGTGACAATCGACTTTTTGTC 274 408 542 4 140–542 0.73
BRU1250_8bp_158bp_5u Bruce07** 1 100 GCTGACGGGGAAGAACATCTAT ACCCTTTTTCAGTCAAGGCAAA 166 158 150 5 150–190 0.78
BRU1134_18bp_348bp_4u Bruce08* 1 75 ATTATTCGCAGGCTCGTGATTC ACAGAAGGTTTTCCAGCTCGTC 330 348 366 4 312–366 0.53
BRU588_8bp_156bp_7u Bruce09 or TR8** 1 94 GCGGATTCGTTCTTCAGTTATC GGGAGTATGTTTTGGTTGTACATAG 140 156 124 8 124–244 0.72
BRU221_19bp_127bp_2u Bruce10 1 90 ATCAATTCGCGGATATTTCACT AGTGCGTTTCATATGTTTGCTG 146 127 165 2 127–146 0.26
BRU211_63bp_257bp_2u Bruce11* 1 80 CTGTTGATCTGACCTTGCAACC CCAGACAACAACCTACGTCCTG 509 257 383 6 257–698 0.84
BRU73_15bp_392bp_13u Bruce12* 2 58 CGGTAAATCAATTGTCCCATGA GCCCAAGTTCAACAGGAGTTTC 345 392 375 7 302–452 0.82
BRU19_8bp_196bp_2u Bruce13 2 100 CGAACGATAGACCAGAACATGC TTGAAAGAATCAGATAAGATAAAGCA 204 196 220 10 196–300 0.85
BRU18_8bp_102bp_7u Bruce14 2 100 TTGCTTTATCTTATCTGATTCTTTCAA GGTGTCGTTGGAGATAGAGGTC 142 102 94 11 70–214 0.93
BRU1112_264bp_346bp_1u Bruce15 2 81 GCGGTGTTGTGTCTGTGGATA GCCGTCAGTATCCACGTCATAG 875 346 4112 7 346–2458 0.83
BRU548_8bp_152bp_3u Bruce16** 2 100 ACGGGAGTTTTTGTTGCTCAAT GGCCATGTTTCCGTTGATTTAT 168 152 176 8 144–240 0.85
BRU344_5bp_110bp_3u Bruce17 2 100 TTTTCACAGGGCATGTTCTCAG CGCGTTTCGATTGTGGAAAATA 125 110 115 6 110–135 0.79
BRU339_8bp_146bp_5u Bruce18** 2 87 TATGTTAGGGCAATAGGGCAGT GATGGTTGAGAGCATTGTGAAG 138 146 154 6 130–170 0.82
BRU324_6bp_163bp_18u Bruce19 2 59 GACGACCCGGACCATGTCT ACTTCACCGTAACGTCGTGGAT 169 163 184 7 76–190 0.79
BRU329_8bp_148bp_7u Bruce20 or TR4 2 100 AATACTGGGTCCAGTCCGATG AGCGCAGCGACCATATTCT 100 148 124 ND ND ND
BRU329_8bp_148bp_6u Bruce21** 2 68 CTCATGCGCAACCAAAACA GATCTCGTGGTCGATAATCTCATT 175 148 164 3 148–175 0.57
BRU322_8bp_158bp_6u Bruce22 or TR1 2 98 GATGAAGACGGCTATCGACTG TAGGGGAGTATGTTTTGGTTGC 150 158 134 10 125–214 0.9
56 tandem repeats with a predicted different length in 2/3 genomes:
vntr a alias name a Chr % b upper primer lower primer b.suis c b.mel c b.abor c nb of different alleles e min-max bp f HGDI g
BRU1990_9bp_152bp_1u Bruce23 1 88 ATCAGCGAGTCGAAGGTCAGTT TTCGACTATGCCAATCCAGATG 161 152 161 2 152–161 0.26
BRU1940_8bp_146bp_8u Bruce24 or TR5 1 100 AGGGGAGTATGTTTTTGGTTGC GCTACAAGATCGAAGTGCTCCA 146 146 106 10 106–217 0.88
BRU1915_8bp_215bp_2u Bruce25 or TR3 1 100 GGGAGTATGTTTTGGTTGCACA CTATTTCGTCCTGCCATTCGAC 239 215 239 8 215–736 0.9
BRU1704_12bp_189bp_5u Bruce26 1 68 TCTTCATCCTGCGAGATCATGT ATTCGTGATCGGGGTGATGAT 162 189 189 2 162–189 0.5
BRU1609_8bp_170bp_6u Bruce27 1 76 TCGACGTCGTCTGACATTTTCT GGGAGTAAGGCAGTAGGGGAAT 170 170 162 3 162–178 0.61
BRU1599_11bp_147bp_4u Bruce28 1 95 TATCTTCCACGGCCATGAATC GGCAGGATCGGCGTATAGATAA 136 147 136 2 136–147 0.1
BRU1528_15bp_132bp_3u Bruce29 1 81 TTGCGTTATTGATTGTCAGCAC GCTGTGGCTCGTCTATGTGG 132 132 117 2 117–132 0.47
BRU1505_8bp_151bp_6u Bruce30 or TR2** 1 96 TGACCGCAAAACCATATCCTTC TATGTGCAGAGCTTCATGTTCG 127 151 151 5 119–151 0.7
BRU1475_18bp_120bp_1u Bruce31 1 100 GCTGAATCTTTTCCGCATCCT GGAATCTCTGCACTGACAAAGC 138 120 120 2 120–138 0.51
BRU1424_8bp_106bp_5u Bruce32 1 88 AGGTTTCCGGCGATAATGG TCGGGATGCGCTCTAGAATATC 106 106 98 3 98–114 0.6
BRU1413_15bp_158bp_4u Bruce33 1 81 GATGGAGCTTGGTTCCTGCTT GCATGATCCGTTTTCTTCTCAA 143 158 143 3 128–158 0.5
BRU1409_18bp_83bp_2u Bruce34 1 84 GCGATCGAAGGAAATATCGAG CGCTGCCGGGATGTGAAC 101 83 101 2 83–101 0.26
BRU1282_10bp_136bp_4u Bruce35 1 91 TGCGATAACAGGTGTACCCAAG GACGGCAGCCATGCTGAT 116 136 116 3 116–136 0.27
BRU1234_15bp_157bp_4u Bruce36 1 76 TAAGGCTCTTGCGTTTGTATCG TGCGTATCTTCAGACTGGCAAT 142 157 142 2 142–157 0.38
BRU1176_21bp_124bp_2u Bruce37 1 95 CCAAGCGTATCATCGATCTGTC TCGGACGCAGATTGTTTCTATC 103 124 123 2 103–124 0.51
BRU1116_18bp_108bp_2u Bruce38 1 100 CTGAATTGGGAGGAGGAACCAG AGCTGAACGACCTTGGCATCT 126 108 108 2 108–126 ND
BRU1112_15bp_164bp_7u Bruce39 1 66 GAAGGTCTCGAAGGAAGAGCTG CCATCCATATTGATCGTCAGGA 164 164 146 2 146–164 0.51
BRU1048_15bp_94bp_2u Bruce40 1 85 AAAAGAAGGGTTTCCCCATACC GGAAAGGACAGCTTCGAGTACC 109 94 109 3 94–109 0.34
BRU1030_13bp_94bp_1u Bruce41 1 100 TTATGTCACCGCTGACGAATTT CTCATTATGGACCCGGTCTTTC 107 94 107 2 94–107 0.1
BRU424_125bp_539bp_4u Bruce42* 1 96 CATCGCCTCAACTATACCGTCA ACCGCAAAATTTACGCATCG 538 539 289 5 164–789 0.75
BRU379_12bp_182bp_2u Bruce43* 1 69 TCTCAAGCCCGATATGGAGAAT TATTTTCCGCCTGCCCATAAAC 170 182 182 3 170–194 0.55
BRU256_12bp_110bp_3u Bruce44 1 96 GGCGCAAGATCGGAATGC AGGCAGGTGCTGATTCTCCT 110 110 122 1 110 0
BRU233_18bp_151bp_3u Bruce45* 1 70 ATCCTTGCCTCTCCCTACCAG CGGGTAAATATCAATGGCTTGG 187 151 151 4 133–187 0.65
BRU217_15bp_256bp_4u Bruce46 1 81 AAAAGCTTCCGAACCAAGTGTC GGAGCTGGTTGAGCGTTATTTC 256 256 241 2 241–256 0.5
BRU149_15bp_116bp_2u Bruce47 1 90 CTGCCAAGGGCGAGATAAAC CATCGTTCTGATCTTCGTGACC 131 116 131 2 116–131 0.26
BRU131_29bp_131bp_2u Bruce48 1 95 TATAAGTCCAGCCCATGACAGG GCGGAATATCTGGATGGGATAC 131 131 160 2 131–160 0.51
BRU112_13bp_266bp_2u Bruce49 1 97 AACCTCGGTCTATGATGCAACC ACGCAGGGTTAGGTTTCTCAAA 279 266 265 2 266–279 0.52
BRU80_12bp_162bp_3u Bruce50 1 75 GCAGAACCTGATGAACAACCTG ATTTTCTGGTCGAGATCGAAGG 174 162 174 2 162–174 0.26
BRU80_15bp_74bp_2u Bruce51 1 90 TGACATGATGCAGAAAATGCAG GTCCCTTGCCGCCTTTCAT 74 74 89 2 74–89 0.47
BRU50_15bp_185bp_3u Bruce52 1 95 CAATGAACCAGATCAGCTTTCG CGCCATGGTTTCAATATCACC 170 185 170 2 170–185 0.26
BRU50_30bp_110bp_1u Bruce53 1 70 CGGTTATGGTGTGGAGCAACT CTTCCAGCGGGCTTTCAG 140 110 110 2 110–140 0.52
BRU28_13bp_150bp_1u Bruce54 1 100 CCGATCACAGACACAACAACTTC GCGAAAAGGGAGCAGACATTAT 163 150 163 2 150–163 0.26
BRU2066_40bp_273bp_3u Bruce55* 1 80 TCAGGCTGTTTCGTCATGTCTT AATCTGGCGTTCGAGTTGTTCT 234 273 273 5 194–354 0.69
BRU2028_12bp_135bp_4u Bruce56 1 79 TTGGTCGTTAGAACAAGAGTGG CTGAACCTGTTCCGTCAAATCA 135 135 123 2 123–135 0.38
BRU69_9bp_301bp_4u Bruce57 2 90 ATGGGAGCCTATTTCGCTTACA GGCGGTAGAATGGATAGCTCAC 292 301 292 3 283–301 0.19
BRU33_24bp_98bp_1u Bruce58 2 82 CATCCTGCTTGGTGTTCTTTTG GATGGTCGTCACCAAGTCCAG 122 98 122 2 98–122 0.32
BRU33_9bp_256bp_7u Bruce59 2 78 CGTATCATCCGGCAATGGT CTTTCTCTTTGTCGTGGGCTTC 265 256 256 2 256–265 0.38
BRU24_12bp_279bp_3u Bruce60 2 90 AGCAAATGAATATGTCGCGTTG TTCACCCCGATATCGATGAAT 267 279 279 2 267–279 0.38
BRU22_12bp_162bp_5u Bruce61 2 75 CCTAATTTCGCCATTCGGTAAC TTGCGGATTTTCCGAATAGAAC 162 162 150 2 150–162 0.5
BRU979_18bp_140bp_3u Bruce62 2 85 CTGACGCAGGGAAGCTTTGT GAAAGAATGGTGAGCAGCAAGA 155 140 155 2 140–155 0.26
BRU833_15bp_145bp_3u Bruce63 2 77 AGGGTGACATTTGTTGGAGTCA GTGGACAGACCCATGGTAAACG 160 145 145 2 145–160 0.51
BRU832_14bp_104bp_1u Bruce64 2 93 GAGACGACGCTTGAGGTTTTTC CTTCCGGCGCTTCTTTCTTAT 118 104 118 2 104–118 0.26
BRU824_41bp_182bp_2u Bruce65 2 94 CGCTCTAGGCATAGCTGTTGTG GTCCAGCCGATAACCTTGCTAT 143 182 143 1 142 0
BRU652_17bp_91bp_1u Bruce66 2 100 ATATCCATGCGGGAAGGAAGAT TATGCAGTGGGCATTCTCTACG 108 91 91 2 91–108 0.32
BRU609_31bp_155bp_2u Bruce67 2 68 GCACCAGTGCGAGAAAATAGTG AATTTTCCTTCGCGACTCCTTT 124 155 155 2 124–155 0.52
BRU564_18bp_111bp_3u Bruce68 2 79 GACAACGATCCGCAGAAAGG GTCAATGCCCTGATCGGTATC 111 111 93 2 93–111 0.47
BRU488_57bp_181bp_1u Bruce69 2 100 CGATGACAGAGCAAGACCGTTA TTGACCGATAATTCTGCAATGG 181 181 238 1 181 0
BRU339_21bp_146bp_2u Bruce70 2 74 GAGTAAGGCGAATAGGGGGAAC AACTCTTCTTCCGCGACAACAC 146 146 162 2 146–162 0.51
BRU337_12bp_394bp_3u Bruce71 2 79 GAAGACGGCTATCGACTGGTCT ACAAGCTCTATTCGCCTTACGC 370 394 370 ND ND ND
BRU322_8bp_230bp_8u Bruce72 2 66 GAAGACGGCTATCGACTGGTCT GTTTCAATGAAGGCGAGGTGAG 206 230 206 10 198–294 0.87
BRU285_28bp_178bp_3u Bruce73 2 86 GTGGAAGGCGTTGTCATTCTG ATCGGTCATGGTCTATCCTTCC 178 178 150 2 150–178 0.51
BRU275_8bp_147bp_6u Bruce74 2 85 GGATGAGGATTGAGGGCTTTT ACGCAGACGATTTAACAAAGCA 139 147 139 4 131–155 0.63
BRU250_19bp_82bp_2u Bruce75 2 100 AGGACTATCAGGTGCGTGACAA AAGGAAGACGTCGCTGAAAGAC 82 82 101 2 82–10 0.52
BRU181_14bp_122bp_2u Bruce78 2 87 CTAACAAATGACGGCAGAGTGC TTGAACGCAAGCTTATCCAAAA 136 122 136 2 122–136 0.32
BRU163_12bp_141bp_4u Bruce79 2 65 TCCTGTTGAACGCAAGCTAATG ATACTTCAGGCGGGGAGGAC 153 141 153 ND ND ND
BRU542_12bp_178bp_4u Bruce80 2 87 CGAGGAATGTCAGGAAGATCAC ACACAGACGCCAAAAGACAAA 166 178 166 2 166–178 0.18
  1. * markers constituting MLVA-15 ; the 8 non-octamers (*) are panel 1, the 7 octamers (**) are panel 2
  2. a naming nomenclature includes repeat unit size, PCR product size in strain 16M, corresponding repeat copy number, and common name;
  3. b internal repeat homogeneity ; c expected PCR product size in each of the three sequenced genomes, Brucella suis 1330, B. melitensis 16M, B. abortus 9–941;
  4. d number of alleles observed in the 21 strains ; e observed size range ; f HGDI : Hunter-Gaston diversity index ; ND, not determined