Skip to main content

Table 1 PCR primers and FISH probes used in this study

From: Design and evaluation of 16S rRNA sequence based oligonucleotide probes for the detection and quantification of Comamonas testosteroni in mixed microbial communities

Name Sequence 5'-3' TM/FAa Positionb Reference
CteA1-for CGAAAAGCCTGGGGCTAATAT 58°C 449-469 this study
CteA1-rev CCATCTCTGGTAAGTTCCTGC 60°C 1019-999 this study
CteA2-for TTGACATGGCAGGAACTTACC 58°C 991-1011 this study
CteA2-rev TCCCATTAGAGTGCTCAACTG 58°C 1157-1136 this study
341F CCTACGGGAGGCAGCAG 60°C 341-356 [14]
534R ATTACCGCGGCTGCTGGC 60°C 534-517 [14]
27F AGAGTTTGATCATGGCTCAG 55°C 8-27 [35]
1492R GGTTACCTTGTTACGACTT 53°C 1510-1492 [35]
CteA CATGACCCGGGGATATTAGC 30% 481-462 this study
Eub338 GCTGCCTCCCGTAGGAGT 30% 355-338 [38]
Eub338-II GCAGCCACCCGTAGGTGT 30% 355-338 [39]
Eub338-III GCTGCCACCCGTAGGTGT 30% 355-338 [39]
  1. a Melting temperature for PCR primers or formamide concentrations for FISH probes, respectively
  2. b Position on the E. coli 16S rRNA sequence