Skip to main content

Advertisement

Table 2 Primers used in this study

From: Investigating the role of small, acid-soluble spore proteins (SASPs) in the resistance of Clostridium perfringens spores to heat

Primers name Primer Sequencea Positionb Gene Usec
CPP 7 5' GCTTACAAATTACCAAAGCC 3' -36 to -17 ssp1 PCR, Se
CPP 8 5' CAGTATTAGCGAAAGGTTTG 3' 83 to 202 ssp1 PCR, Se
CPP 9 5' CTCCTATAATTCCCTCTCAT 3' -105 to -86 ssp2 PCR, Se
CPP10 5' GTAGACTTTAATAGGTTCAGG 3' 180 to 200 ssp2 PCR, Se
CPP11 5' CTGCACATCATAATATTGAAAGG 3' -80 to -58 ssp3 PCR, Se
CPP 13 5' GAGGGTCCTATTGTAGGAGGATT 3' -2010 to -1888 ssp3 MP, SB
CPP 16 5' ATAGCAGGAGGAGCTATTCCAC 3' 2099 to 2120 ssp3 MP, SB
CPP 21 5' CGGAGACCTTAGCTCAAGTTAACGCGGAAGCGTTGGTGGAG 3' 95 to 135 ssp3 SDM
CPP 22 5' CTCCACCAACGCTTCCGCGTTAACTTGAGCTAAGGTCTCCG 3' 95 to 135 ssp3 SDM
CPP 34 5' GCTATGGATCTTATGGAAGG 3' 423 to 442 ssp3 PCR, Se
CPP37 5' CGGCTTCTAGCACATCTTCT 3' -1662 to -1593 ssp2 MP, SB
CPP38 5' TATGTGGAGCAGGAATTGCC 3' 1449 to 1469 ssp2 MP, SB
CPP47 5'GTACCATTCTCAGATTACAATGTCGCGAAGCGTTGGTGGAGAAATGG3' 73 to 113 ssp2 SDM
CPP48 5' CCATTTCTCCACCAACGCTTCGCGACATTGTAATCTGAGAATGGTAC 3' 73 to 113 ssp2 SDM
CPP45 5' CCAGGAAAGTATGGACAAGC -1564 to -1544 ssp1 MP
CPP139 5' CCTCACCATTATCCTCTACAAG 3' 1782 to 1802 ssp1 MP
CPP104 5' GCTAGAGAATTAGGGGTACCTCGCGACCTAAGTTCAAGACAA 3' 60 to 116 ssp1 SDM
CPP105 5' TTGTCTTGAACTTAGGTCGCGAGGTACCCCTAATTCTCTAGC 3' 60 to 116 ssp1 SDM
CPP 57 5' GCGTCGAC CTGTTTGAGCTTTTTTC 3' -200 to -213 ssp3 promoter GUS
CPP 58 5' GCTGCAG CCTGGAACTAAATGTTGT 3' 3 to 21 ssp3 promoter GUS
CPP 63 5' GCGTCGAC TAGGTGCAGAAGC 3' -219 to -203 ssp1 promoter GUS
CPP 64 5' GCTGCAG CTGGAACTAATGATTTTGAC 3' 3 to 21 ssp1 promoter GUS
CPP 65 5' GCGTCGAC GGAACTAAAGCTAAATTTGG 3' -238 to -223 ssp2 promoter GUS
CPP 66 5' GCTGCAG GCTTCTGGTACTAAATGTTGTG 3' 3 to 25 ssp2 promoter GUS
  1. a Restriction sites are marked by underlining.
  2. bThe nucleotide position numbering begins from the first codon and refers to the relevant position within the respective ssp gene sequence [18].
  3. cPCR, polymerase chain reaction; Se, sequencing studies; MP, construction of mutator plasmid; SB, southern blot analysis; SDM, site-directed muatgenesis. GUS, construction of plasmid for β-glucuronidase assay.