Skip to main content

Advertisement

Table 4 Bams30 allele codes

From: Genotyping of Bacillus anthracis strains based on automated capillary 25-loci Multiple Locus Variable-Number Tandem Repeats Analysis

Table 4A      
Genotype cluster Bams30 allele PCR fragment sizea observed sizea allele codingbc
1 A1a 75 889 906 (+17) ABCD EEFGGHGGG IG GJ abcdefcdghdghdefciefjkgk
42 A3a 75 889 906 (+17) ABCD EEFGGHGGG IG GJ abcdefcdghdghdefciefjkgk
41 A3a 75 889 906 (+17) ABCD EEFGGHGGG IG GJ abcdefcdghdghdefciefjkgk
33 A1a 75 889 906 (+17) ABCD EEFGGHGGG IG GJ abcdefcdghdghdefciefjkgk
55 D 75 889 906 (+17) ABCD EEFGGHGGG IGLGJ abcdefcdghd efciefjkgk
34 A1a 72 862 874 (+12) ABCD EEFGGHGGG IG J abcdefcdghdghdefciefjkgk
37 A1a 72 862 874 (+12) ABCD EEFGGHGGG IG J abcdefcdghdghdefciefjkgk
4 A1a 72 862 874 (+12) ABCD EEFGGHGGG IG J abcdefcdghdghdefciefjkgk
54 A4 71 853 865 (+12) ABCD EEFGMHGGG I LGJ ab cdghdghdefciefjkgk
67 C 71 853 ND ABCD EEFGGHGGGGGI LGJ abcdef ciefjkgk
5 A1a 69 835 848 (+13) ABC EFGGHGGG IG GJ abcdefcdghdghdefciefjkgk
58 E 60 754 763 (+9) ABCD EEFGG IG IJ abcdefcdghd efciefjkgk
57 E 60 754 763 (+9) ABCD EEFGG IG IJ abcdefcdghd efciefjkgk
51 A3b 57 727 735 (+8) ABCD EEFGGHG J abcdefcdghd efciefjkgk
53 A3b 57 727 ND ABCD EEFGGHG J abcdefcdghd efciefjkgk
52 A3b 53 691 698 (+7) ABCD EEFGGHG J abcdefcdghd efjkgk
46 A3b 51 673 680 (+7) ABCDEEEFG J abcdefcdghd efciefjkgk
48 A3b 51 673 681 (+7) ABCDEEEFG J abcdefcdghd efciefjkgk
49 A3b 31 493 496 (+3) ABCD EFGGH lj gk
63 B2 17 367 369 (+2) AB cdghd efjkgk
64 B2 17 367 369 (+2) AB cdghd efjkgk
66 B2 17 367 369 (+2) AB cdghd efjkgk
62 B2 17 367 369 (+2) AB cdghd efjkgk
59 B1 6 268 270 (+2) AK
CEB9727 thuring.     ABCDEBGIIIGGGIBJ and ff**ff***fgdgfcafgh**abcdfabciefcfgfjka*
Table 4b      
27 bp repeat unit code   9 bp repeat unit code    
A CAACAGGAATAACGGGAGCAACCGGTG a CAACGGGAG   
B CAACAGGAATAACGGGAGCAACAGGTC b ACACAGGTC   
C CGACGGGAACAACAGGAGCGACCGGTG c TAGCAGGAG   
D CGACAGGAATAACGGGAGTGACCGGTG d CAACGGGCC   
E CAACAGGAATAACGGGAGTGACCGGTG e CGACAGGAG   
F CAACAGGAATAACGGGAGTGACAGGTC f CAACAGGTC   
G CGACGGGAATAACGGGAGCAACAGGTC g CAACAGGAG   
H CGGCGGGAATAACGGGAGTGACAGGTC h ATACTGGAG   
I CGGCGGGAATAACGGGAGCAACAGGTC i CAACAGGCC   
J CGACGGGAACAACAGGAGTAACCGGTC j TAACGGGAG   
K CAACAGGAATAACGGGAGCAACAGGTG k CAACTGGTG   
L CGACGGGAATAACGGGAGTAACCGGTC l CGACGGGAA   
M CGACGGGAATAACGGGAGTAACAGGTC     
  1. a the PCR fragm ent size is the exact size, as deduced from sequence data.
  2. The observed size is as m easured by capillary electrophoresis (the offset is indicated, and is proportional to allele size)
  3. b Upercase letters: 27 bp repeat units; Lowercase letters: 9 bp repeat units
  4. c "*" represent 9 base-pairs repeat units with a sequence m otif not observed in the B. anthracis alleles