Skip to main content

Advertisement

Table 1 The apoptosis family genes and their PCR primers

From: RETRACTED ARTICLE: Temporal activation of anti- and pro-apoptotic factors in human gingival fibroblasts infected with the periodontal pathogen, Porphyromonas gingivalis: potential role of bacterial proteases in host signalling

Gene, Accession # Sense Antisense
Bfl-1, NM_004049 TTACAGGCTGGCTCAGGACT CCCAGTTAATGATGCCGTCT
Boo, NM_020396 GAAGAAGTGGGGCTTCCAG GAAAGGGGGTCCTGAAGAAG
Bcl-XL, NM_138578 GTAAACTGGGGTCGCATTGT TGGATCCAAGGCTCTAGGTG
Bcl-2, NM_000633 ATGTGTGTGGAGAGCGTCAA ACAGTTCCACAAAGGCATCC
Mcl-1, NM_021960 TAAGGACAAAACGGGACTGG ACCAGCTCCTACTCCAGCAA
Survivin, NM_001168 GGACCACCGCATCTCTACAT GACAGAAAGGAAAGCGCAAC
Bcl-w, NM_004050 GCTGAGGCAGAAGGGTTATG CACCAGTGGTTCCATCTCCT
Nip3, NM_004052 CTGGACGGAGTAGCTCCAAG TCTTCATGACGCTCGTGTTC
Hrk, NM_003806 CTAGGCGACGAGCTGCAC ACAGCCAAGGCCAGTAGGT
Bak, NM_001188 TTTTCCGCAGCTACGTTTTT GGTGGCAATCTTGGTGAAGT
Bik, NM_001197 TCTTGATGGAGACCCTCCTG GTCCTCCATAGGGTCCAGGT
Bok, NM_032515 AGATCATGGACGCCTTTGAC TCAGACTGCAGGGAGATGTG
Bax, NM_004324 TCTGACGGCAACTTCAACTG CACTGTGACCTGCTCCAGAA
Bad, NM_004322 CGGAGGATGAGTGACGAGTT CCACCAGGACTGGAAGACTC
Bim, NM_207003 TGGCAAAGCAACCTTCTGAT TCTTGGGCGATCCATATCTC
Moap-1, NM_022151 CAGTGGGTGAGTTGAGCAGA GAAACATCCAGCGTCCAAAT
  1. The common names of the anti- and pro-apoptotic genes and their RefSeq accession numbers (GenBank) are shown here. The sense and antisense sequences correspond to the RT-PCR primers used for amplification of the transcripts by real-time PCR (Fig. 8). All sequences are written 5' to 3'.