Skip to main content

Table 1 Oligonucleotide primers used for module jumping and amplifications

From: Cereulide synthetase gene cluster from emetic Bacillus cereus: Structure and location on a mega virulence plasmid related to Bacillus anthracis toxin plasmid pXO1

Primer Sequence (5'-3') Use
F_C3a GCA(CT)CA(CT)AT(ACT)AT(ACT)TC(AGCT)GA(CT)GG(AGCT)TGG Module jumping (C-A domain)
R_T1a C(AGT)A(GT)(AGT)A(AG)(AT)GA(AG)TG(ACT)CC(AC)CC Module jumping (A-T domain)
F_A3 GG(ACT)(AT)C(AGT)AC(ACT)GG(ACT)(AC)A(AGCT)CC(ACT)AA(AG)GG Module jumping (A-T domain)
PL10987_R2 CCGTTATCAGCAATAGTCCTA Primer derived from pBc10987
PL10987_R4 GAATATACTCAACAGTAGCTACC Primer derived from pBc10987
PL10987_R5 CGATACGTCAAATGTACTCGG Primer derived from pBc10987
PL10987_R6 GTGATTCATATTGTCTGGATACG Primer derived from pBc10987
PL10987_F20 GAAGAGAGATATGTCTGTACT Primer derived from pBc10987
PL10987_F21 GTATATTGTGGCAATTGATGAAGC Primer derived from pBc10987
  1. a) see reference [22]. Primers for hybridization studies are provided in the supplement (see additional file Table S1); primers for inverse PCR and control sequence reaction are not shown