Skip to main content

Table 4 Primer pairs used for PCR amplification of unique and differential regions in 18 Brucella biovars. Sequences of primer pairs, which where use to PCR amplify several differential genes across the 18 Brucella biovars along with the expected amplicon size and predicted gene function.

From: Molecular targets for rapid identification of Brucella spp

Primer pair number Forward primer ... Reverse primer ORF name Amplicon size, bp Gene function
   B. abortus B. melitensis B. suis  
1 TGATAGCGCCAGACAACAAC ... TGTGCCAGCTTCGTTGTAAG BruAb1_1825 596 BMEI0205 470 BR1846 722 Immunoglobulin-binding protein EIBE
6 TGCAGCTCACGGATAATTTG ... ACACCTTGTCCACGCTCAC BruAb2_0168 783    Outermembrane transporter
7 AGCTTCTGGAGGAGGTGGAT ... GTTCCGCCTTGTGTTTCTTC   BMEII0827 526 BRA0439 526 Glucose-1-phosphate cytidylyltransferase
8 TCTACACCACGCTGAAGTCG ... CCGAAAGCCGATAGAGTTTG BruAb2_1035 393 BMEII0204 162 BRA1096 393 Transcriptional regulator, GNTR family
10 TCATGCTGTGCCTCCAATTCC ... TTGCTGAGCAGCAGCAAGAAC BruAb1_0248 184 BMEI1699 184   Hypothetical protein
Control TCAGGCGCTTATAACCGAAG ... ATCTGCGCATAGGTCTGCTT BruAb2_0582 261 BMEII0637 261 BRA0644 261 pcaC 4-carboxymuconolactone decarboxylase