Skip to main content

Table 2 Oligonucleotide primers used for PCR amplification and sequencing of rickettsial species. The position of the 5' nucleotide of each primer is numbered with respect to the sca 1 gene sequence of R. conorii.

From: Sca 1, a previously undescribed paralog from autotransporter protein-encoding genes in Rickettsia species

Primer name Sequence in sca 1 (5' – 3') 5'Position in sca 1
1f ATGAATAAGTTAACAGAACA 1
2r TGATCCTCTATAGGAACATC 335
2f ACCCCGCAGCAGATAGGA 198
3r TTGGTGTATTAGGTGCAGT 565
3f AGCGTCTTCGCCTACTGT 521
4r AAATGTCGGCTTCGGAGGA 813
4f AGCAGTAGCGGCCCGCAA 753
5r TTGTAACCGGAACTGTTTCCT 1198
5f AGAAACAAAAATCAAAATAGGTGA 1031
6r TTTCGCACTAGCAGCTACTT 1434
6f AATCAAGCGGAGGTAATGCA 1279
7r GGCACTAAGTACCCCTCTTCA 1667
7f ACTCCTGTTGTTTATAATAGT 1530
8r AACTTTCTCATTTCTGTTGCT 1851
8f TGAAGAGGGGTACTTAGTGCC 1646
9r AGATATTTCCGCTTGCTCA 1989
9f AGCAACAGAAATGAGAAAGTT 1850
10r TCTGAACGAACGCGTCGCCA 2248
10f TGAGCAAGCGGAAATATCT 1979
11r TCTCCGAAATACTTCCACTT 2371
11f TGGCGACGCGTTCGTTCAGA 2228
12r TGTTCTTTGCTTTGAGGTTTCTCCA 2616
12f TGCGTACAGAAACTTTAGGT 2395
13r AGGCTTATAAGCTGAGTTGCCT 2726
13f TGGAGAAACCTCAAAGCAAAGAACA 2591
14r TTATAAGCTTTTATATCTTCCGGTT 2894
14f AGGCAACTCAGCTTATAAGCCT 2704
15r ATATCCATATTAGCAGTTGGCAT 3032
15f AACCGGAAGATATAAAAGCTTATAA 2869
16r TATTATATATTGAAGCATCTACATCT 3220
16f ATGCCAACTGCTAATATGGATAT 3009
17r TTCTCATAACTAACCGACTCATA 3365
17f AGATGTAGATGCTTCAATATATAATA 3150
18r TTTCTTGTCAAGCTCGGCACTT 3483
18f TATGAGTCGGTTAGTTATGAGAA 3342
19r AGAAAATTCTGCTTCTATGGCTT 3687
19f AAGTGCCGAGCTTGACAAGAAA 3461
20r ATCCTCTAAGCCACTAACCGA 3816
20f AAGCCATAGAAGCAGAATTTTCT 3664
21r ATACCGGCTTACTCTCAGTT 3997
21f TCGGTTAGTGGCTTAGAGGAT 3795
22r TAGAACTTGAGCCAGACAATTCT 4201
22f AACTGAGAGTAAGCCGGTAT 3977
23r TTCGCGAAGTAACGAAGAAA 4350
23f AGAATTGTCTGGCTCAAGTTCTA 4178
24r TAATGCTAATGCACTCTCATTACTT 4521
24f TTTCTTCGTTACTTCGCGAA 4330
25r ATCCCCATCGGAATCGGATA 4644
25f AAGTAATGAGAGTGCATTAGCATTA 4496
26r TTAGACATATTCATAGATGCATCTAA 4817
s1.cono.f* TGAGGGTATGGCGATGAGT 95
s1.cono.r* CAGTAGGCGAAGACGCTG 502
  1. f = forward primer; r = reverse primer; *primers used for RT-PCR.