Skip to main content

Advertisement

Table 5 Oligonucelotide primers

From: Identification of potential CepR regulated genes using a cep box motif-based search of the Burkholderia cenocepacia genome

Primer Sequence   Restriction Site or size of product (bp)
PCR Oligonucleotides
cepIfor CAGGCGGCGATAGCTTG  
cepIrev CACAGATCCGAGGACATCCA  
EXcepR3 CGGGATCC GAGAAAGAATGGAACTGCGC Bam HI
EXcepR2 CGGGATCC TTGCGTCAGGGTGCTTCGATG Bam HI
oligonucleotides used to clone promoters position of 5' basea Size (bp)
aidA CAGATTCAATGTCGCG 3:329288 272
  GCACATCGGTAACGCG 3:329016  
scpB CTGCAACGAACGACGCG 2:1062555 294
  GACGGAAGGGGAAGGGC 2:1062261  
cepI GCCTGCAGGGCACAACGACGCCTATCATGC 2:2087932 267
  GAACGAAGGTCTGCATGGATG 2:2088199  
PBP CGTCGGGAACGAGGCCC 2:2983704 313
  CGATGGGTTGGCGGTGGG 2:2983391  
phuR CGTGTCGATGATCCGCG 2:2973940 404
  CACAGGTGGTCTCCC 2:2974344  
acyltransferase CGATACACTGTGAGCCG 2:446287 336
  GTCCTTCAGCACGCCG 2:445951  
zmpA CTCGAGGCTGGCCGGTACTG 3:478051 638
  GGATCCAGACTGAAGGCGGACG 3:478689  
MST005 GCACGCCCGCGTCAGGCG 1:366108 325
  CGCAAGCCACCACTACCCC   
MST011 CCTTGCTGAGATTGCCGGC 1:779005 321
  GACAGCGCGTTCACGGGCG   
MST028 CGTGTCGTTGCGGCGCGC 1:1484174 451
  GTCTGGCTGTACGCACGCC   
MST052 CCGTCATTTGTCGTCGGGC 1:3009328 341
  CCAGTCCATCGTGGCCGC   
MST059 CGCCTTCGGCAGCCCCG 1:3488873 315
  GCTGGTCGAGCAGCAGCGG   
MST068 CGTCGAGCGTCAGCTTGCGC 2:11203 325
  GGTCGAGCGTCCCGCGC   
MST072 GCATCCAGCAGGCGCGC 2:84846 398
  CCGACGGGACCGCAGCCC   
MST112 GCAGGTCGCCATGCCGGG 2:2156170 441
  ACCACGCGTACGCGGGC   
Mutagenic Oligonucleotides
CepBx103 GCGTCTTTACGCGTCGAC CCTGTAAGAGTTACC Sal I
CepBx104 GTCTTTACGCCGTCATATG GTAAGAGTTACCAG Nde I
CepBx105 CGCCGTCACCCCTGCAG AGTTACCAGTTACAGG PstI
CepBx106 GCCGTCACCCTGCTGCAG TTACCAGTTACAGG Pst I
CepBx107F ACGCCGTCACCCTGTAACTAGT ACCAGTTACAGGCTCCTC Spe I
CepBx107R GAGGAGCCTGTAACTGGTACTAGT TACAGGGTGACGGCGT Spe I
CepBx108F CCGTCACCCTGTAAGAGTCTAGA GTTACAGGCTCCTCGTGC Xba I
CepBx108R GCACGAGGAGCCTGTAACTCTAGA CTCTTACAGGGTGACGG Xba I
CepBx109F CACCCTGTAAGAGTTACCGTCGAC AGGCTCCTCGTGCCGCGC Sal I
CepBx109R GCGCGGCACGAGGAGCCTGTCGAC GGTAACTCTTACAGGGTG Sal I
CepBx110F CCTGTAAGAG TTACCAGTTAAGATCT CCTC GTGCCGCGCG CTG Bgl II
CepBx110R CAGCGCGCGG CACGAGGAGATCT TAACTGG TAACTCTTAC AGG Bgl II
CepBx111F AGAGTTACCAGTTACAGGGATATC GTGCCGCGCGCTGTAATG Eco RV
CepBx111R CATTACAGCGCGCGGCACGATATC CCTGTAACTGGTAACTCT Eco RV
CepBx112F GTTACCAGTTACAGGCTCCGTACG CCGCGCGCTGTAATGCAC Bsi WI
CepBx112R GTGCATTACAGCGCGCGGCGTACG GAGCCTGTAACTGGTAAC Bsi WI
CepBx113F CCAGTTACAGGCTCCTCGTCGAC CGCGCTGTAATGCACGC Sal I
CepBx113R GCGTGCATTACAGCGCGGTCGAC GAGGAGCCTGTAACTGG Sal I
  1. a Locations reported as chromosome:nucleotide