Skip to main content

Advertisement

Table 2 Identification of a cep box consensus motif.

From: Identification of potential CepR regulated genes using a cep box motif-based search of the Burkholderia cenocepacia genome

Gene p-valueb direction Sequencec bp to ORFd
First Generation Motif Sequencesa
cepI 2.23E-11 + CACCCTGTAAGAGTTACCAGTT ACAGGCTC 72
phuR 6.53E-10 + TACACTGTTAAAGTTGTCAGTT GCCTTTCA 116
aidA 2.24E-09 - GAAGCTGTAAAAGTAAACAGGT CGGGAAAA 159
zmpA 2.60E-09 + TCTTGTTTAAAAGTCATCACTT GATGCATT 54
Acyltransferase 1.13E-07 - AGGGCTTCAAGTGTAACTCCTT GGAAAGGT 3
scpB 1.25E-07 - CCAGTTTCCATAGCTGTCAGTT CTGACAAC 115
consensus    CTGTAA A AGT TAC CAGTT e  
Second Generation Motif Sequencesf
cepI 4.79E-11 + CACCCTGTAAGAGTTACCAGTT ACAGGCTC 72
phuR 6.11E-11 + TACACTGTTAAAGTTGTCAGTT GCCTTTCA 116
MST072 4.01E-09 + AAAATTGACAAAGTTATCAGTT ATGACTTT 56
aidA 2.16E-08 - GAAGCTGTAAAAGTAAACAGGT CGGGAAAA 159
MST028 5.32E-07 - CTTTCGGCAATAGTTGCCTGTT TCGATTGA 140
zmpA 2.60E-09 + TCTTGTTTAAAAGTCATCACTT GATGCATT 54
MST005 1.24E-06 + CAACCAGTAAAACTTGCGCATT CCGGTCGA 206
MST068 1.60E-06 - CGTTCGCTTAGAGTTGTTCGAT ATTTCGAA 138
MST011 1.80E-06 + TGTCAAGTCAGACTTGACAGCT TGTAAAGG 76
MST059 2.41e-06 + ATGGTTGAAAGTGTCATCCGGT GCTACACT 118
consensus    C TGT A A A AGTT AC C A G T T g  
  1. a The promoter regions of 6 genes experimentally determined to be positively regulated by CepR used to search for common motifs with the MEME (Multiple EM for Motif Elicitation) program.
  2. b The p-value of a site is computed from the the match score of the site with the position specific scoring matrix for the motif. The p-value gives the probability of a random string (generated from the background letter frequencies) having the same match score or higher. (This is referred to as the position p -value by the MAST algorithm.)
  3. c The boxed region represents the region determined to be required for cepI expression as determined in Fig. 1. Bold lettering represents the motif predicted by the MEME program. In the case of cepI the motif matches the CepR binding site [20].
  4. d The number of base pairs to the start codons predicted by alignment with homologous genes.
  5. e Underlined bases are conserved in at least 4 of 6 sequences.
  6. f The promoter regions of 10 genes experimentally determined to be positively regulated by CepR used to search for common motifs with MEME.
  7. g Underlined bases are conserved in at least 7 of 10 sequences.