Skip to main content

Advertisement

Table 1 Forward and reverse primers for PCR and sequencing

From: Effect of iron on the expression of sirR and sitABC in biofilm-associated Staphylococcus epidermidis

Gene forward 5'-...-3' Reverse 5'-...-3'
sirR GCGACGTGTCCTTTGTATCA TGCAAAAATATTCATCGCATTT
sitA GACCTAATGGTGCCGGTAAA TTGGCCCTAAAAACTGCAAC
sitB TTCCTAGCATCTGGCGTCAT CACGTTAAAGCGCTCCTTTT
sitC CGTGTCGGTGGAAATAAGGT TGGCTTGTTTCATTTGACCA
gmk GGATAATGAAAAAGGATTGTTAATCG GCTTCTACGCGCTCTCTTTT