Skip to main content

Advertisement

Table 3 Characteristics of VNTR markers and sequence of the PCR primers

From: Evaluation and selection of tandem repeat loci for Streptococcus pneumoniae MLVA strain typing

Name R6 positiona Locus Motif bp Percent matches R6 amplicon PCR primers No of alleles Allele size range (units) HGDId (56 strains)
      size bp repeats     
Spneu15 1579 BOX 45 94 507 7 TCCAACACGACCTTTATCCA 10 1–12 0.827
        AGCCTTGCTCCTCATCTTGA    
Spneu17 1783 BOX 45 86 167 3 TCGAAAATCTCTGCAAACCA 12 1–13 0.883
        CGGACTAGGCGGCTGATTA    
Spneu19 1925 pcpA 60 98 663 10 TCGGGTGTAGTCGTGTTTACT 5 7–10 0.749
        AACTGATGTAGCTAAACCTAAAAAGAA    
Spneu25 101 BOX 45 96 423 4 TCGCCTTTGCTAATCAAACA 7 1–6c 0.744
        GACTGGGTAACAATTCCATT    
Spneu26 185 intergenic 51 65 492 6 ATGGAACAGAAGGCGAATTG 7 1–9 0.688
        AACAAGGCCAGGATTTTCGT    
Spneu27 257 BOX 45 95 347 3 TCAGGAACAGCTATTATCCC 5 0.5–4 0.575
        CCAACCTCCTTTTCGTTTCA    
Spneu31 557 BOX 45 98 594 9 CTGGAATAGTCCATCGAGCTT 9 1–9 0.763
        CGAAGGTAAATGTGAACAAAC    
Spneu32 571 BOX 45 86 280 2 AAAGCAAAATAATGCGCTCCT 4 1–4 0.629
        ACTACCAAAGCCCAAGTGGT    
Spneu33 698 BOX 45 95 407 2 CAGCTGAACATGATGGCAAA 10 1–10c 0.858
        CATCACTTCTCCCTTCTAATC    
Spneu34 1082 BOX 45 97 239 1 CTCGGTAAAGACGAGGTTCAA 6 1–11 0.598
        CATCGTGCAGGGATTTTCTAA    
Spneu35 1166 intergenic 49 100 349 4 ACAATCTCAGCTACGCCCTA 5 1–5 0.561
        ACGGGATGACATTAAAAACC    
Spneu36 1209 trzA 45 86 320 2 GAAATCTTGATCACAAGTCAC 10 1–10 0.866
        AAAAAGTTGCCTTCGAGTGAC    
Spneu37 1350 BOX 45 91 501 7 ATGCGCAAATCGATTAAGGA 11 2–12 0.876
        CGATGTGCTTCACTCACTCC    
Spneu38 1911 BOX 45 84 297 1.5b TCAGGAGTAGGTTCCTGACCA 6 0.1–4 0.616
        AACCCGAGAAGAAGTGCAAG    
Spneu39 1915 BOX 45 83 275 2 CCTTGGACTACCACCTCGTT 14 2–17 0.862
        GCCGTGACAGACTTCTGGAA    
Spneu40 1611 BOX 45 88 376 3 AGTAGTCTGCAATCGCAGCT 7 2–8 0.832
        GGGCCTTAAGTCGCTTTGAT    
Spneu41 394 intergenic 14 100 166 2 ACCGTAATGGGACTTCATCT 5 1–4 0.484
        ATCTGCACCTAAGACAATCG    
Spneu42 1036 intergenic 12 91 120 3 TGCTCCCTCTGAAAAGTCAT 6 0.1–4 0.739
        CTTTATATTATATCATGCCTTC    
  1. a Position on the chromosome expressed in kbp
  2. b Expected size for a truly 2U amplicon is 312 bp long
  3. c Additional large alleles probably contain an IS element
  4. d Hunter Gaston Diversity index