Skip to main content

Table 1 Primers used in gene inactivation and confirmation

From: ABC transporter FtsABCD of Streptococcus pyogenes mediates uptake of ferric ferrichrome

Primer Sequence (5'-3') Purpose
1 ACCATGGCTATGCCTCAAATTGCTGG ftsB inactivation
2 ACCATGGTTTTCCAATCTTTTAACCAC  
3 ACCATGGAGCTTATGTGTTGCTATTTAC ftsC inactivation
4 ACCATGGATAGCTCCTGCTAAGACAAG  
5 ACCATGGTCTTTTAGTAGCTTGTTCGTC mtsA inactivation
6 ACCATGGTTCATTTCGACAAGAGGCTG  
7 AACTCTACTATTAACACTCTG confirmation of ftsB inactivation
8 GCAACGACGACATAATCACC  
9 GTGTCTCGAGCGTTTTTGC confirmation of ftsC inactivation
10 CAATATAGCCGATCATTTG  
11 ATGAGCCTCATTTTGGGTGC confirmation of mtsA inactivation
12 GCCACATAAGCTTTTAGGTTC  
13 AGAATTTTGTTAGCAGTTCG aad-specific, paired with primer 7, 9, or 11 for inactivation confirmation
14 CTTTGAGTGAGCTGATACCG pFWaad-specific, paired with primer 8, 10, or 12 for inactivation confirmation