Skip to main content

Advertisement

Table 1 Sequence characteristics of primers developed in this study.

From: Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

Name Sequence (5' to 3') Nomenclature Bases Tm
NSA3 AAACTCTGTCGTGCTGGGGATA nu-SSU-1543-5' 22 67
NSI1 GATTGAATGGCTTAGTGAGG nu-SSU-1671-5' 20 59
58A1F GCATCGATGAAGAACGC nu-5.8S-2206-3' 17 61
58A2F ATCGATGAAGAACGCAG nu-5.8S-2208-3' 17 57
58A2R CTGCGTTCTTCATCGAT nu-5.8S-2192-5' 17 57
NLB3 GGATTCTCACCCTCTATGA nu-LSU-2754-5' 19 56
NLB4 GGATTCTCACCCTCTATGAC nu-LSU-2755-5' 20 57
NLC2 GAGCTGCATTCCCAAACAACTC nu-LSU-2821-5' 22 67
Plant control primers    
NSIP GATTGAATGATCCGGTGAAG PC-nu-SSU-1671-5' 20 62
NLBP GCTGTCACCCTCTCAGGC PC-nu-LSU-2755-5' 18 64
  1. Sequences are all listed 5' to 3' for the oligonucleotides. Nomenclature after Gargas and DePriest [23] as extended in this study. Tm is calculated by nearest neighbour method as an on-line service provided by Sigma-Genosys (The Woodlands, TX).