Skip to main content

Advertisement

Table 2 Primers used in PCR

From: HinT proteins and their putative interaction partners in Mollicutes and Chlamydiaceae

Primer Length Sequence (5'-3')
MP1 27 ATTTATTTTTGATTACTATTTTTGAAC
MP2 23 AATTTGTTTTATTATTTTGTTTA
MP8 20 TTAATGTTCATGTCCTTCTT
MP9 21 AATCCAGAAAGTTTTTTTATT
MP12 24 ATTTGTTATTGCTAAAAGATTGTA
UU1 22 ATGATCAATAAAAACAAAAAAT
UU2 19 GCGCCGTTAGTGATGTTAG
UU6 32 TGAGCTCTTCCATATTTTTTGATTATACCATA
UU7 23 AAAAACGAATTGCCTCTATGTAT
Cp1 21 CATGATGCGCGTGGAGTAGGT
Cp2 25 TCCAAGAAGCATTGGTACTCACGAT
Cp3 22 CGGTTTCCATGGCTTCTCTGAC
Cp4 29 TTATCGATGGATTGATAGATTGTGAAAAG
Cp5 22 GGACGCCCACCTAAAAGATGAA
Cp6 21 TTTCGCTTGGTCCCTCTCCTG
Cp7 25 GCTCTTTCAATATCTTCACGGCTCA
Cp8 28 TACGGTGCTGAGCTTAAAGATAGAAATG
Cp_265 up 27 ATGGATCCTA ATGGAGGATTGGCTAAG
Cp_265 low 29 TTGAGCTC TCATATGATCCCTCTATCTTG
Cp_266 up 27 TTAGGATCCTC ATGCCTACGTGCTTTG
Cp_266 low 29 TTTGAGCTC ATCAGGCTATAGCACCTAAA
Cp_267 up 23 ATTGGATCC CCATGTTCGGCTCG
Cp_267 low 30 TTAGAGCTC ACTTGAAAATAGAGAAAAGAG
Cp1 BamHI 27 ATGGATCC ATGGAGGATTGGCTAAG
Cp2 BamHI 27 TTAGGATCC ATGCCTACGTGCTTTG
Cp3 BamHI 23 ATTGGATCC ATGTTCGGCTCG