Skip to main content

Table 1 List of primers used in this study. All sequences are written from 5' to 3'.

From: Crosstalk regulation among group 2- Sigma factors in Synechocystis PCC6803

Primer Sequence
sigB-1 CGGAATTCTTGGGTATCTTTTTAGC
sigB-2 CCGAAGCTTGGGCAACTAACTGGC
sigC-1 CGGAATTCAAAGCCTGCCATCGGCC
sigC-2 CCGAAGCTTGTGGCCTAACCCAAATTTTC
sigD-1 CGGAATTCGAGTATGTGCTTCACAA
sigD-2 CCGAAGCTTCTTTTCTTTAGCTAGCT
sigE-1 CGGAATTCTTTGGAAAATCAATGACA
sigE-2 CCGAAGCTTGGTATCTATAACCAACC
cat-1 CGGGATCCCGCCCGGGAATTACGCCCCGCCC
cat-2 CGGGATCCCGCCCGGGCAGGAGCTAAGGAAGCTA
rpoA-RT TAACCTA
sigB, C-RT TAACCTT
sigA, D, E-RT TAACCCT
glnN-RT CCATCCGTC
sigA forward TGGAGTTGGAAACCGCC
sigA reverse GACTGCACCATTTTGTCTTTGG
sigB forward AGAAATGGCCCGCTATCCC
sigB reverse GCCCGCAGTTGATAAAGCC
sigC forward TGGAGTTGGAAACCGCC
sigC reverse GACTGCACCATTTTGTCTTTGG
sigD forward GATGGCCCTGCTGGAGC
sigD reverse TTGCGCTTCTGATATTTCTTGG
sigE forward CGGGCCGCAGAATCC
sigE reverse CCAACTCCGCCCATCG
rpoA forward GAGTTCGCCACTATTCTAGGCG
rpoA reverse TTAGGATCAATAACCTCCACCTC
glnN forward GATTTAACCAAGGACGCTGGC
glnN reverse CAAAACGGTTACCAGTGAAGGC