Skip to main content

Table 5 oligonucleotides used for mutagenesis of pac sequences

From: In vivo studies of genomic packaging in the dsRNA bacteriophage Φ8

Oligonucleotide Sequence
590 TCTCAGTTTAAACCTAGAGACAAAGCTGAC
591 TCTCAGTTTAAACCGAGATCCCAGGAAATG
592 TCTCAGTTTAAACCACGAATCACCCCGAGC
593 TCTCAGTTTAAACCTTCGCGCCTTTCAGGG
681 GAGTCAGCTTTGTCTCCTTGAGACTGAGCGTTCGG
683 GGCGCGAAGGTCCCCACCTTCTCGGGGTGATTCGT
685 TTCGCTGGCATAGCTCGAGTGAAGCCTTCCCTG
687 CGCTGGCATAGCTCCCCAGAGTGAAGCCTTCCCTG
693 GATCTCGGAGTCAGCTCAGTCTCTAGGAGACTG
699 GTTCGGTCTCAGGTTTAACCTGAGATTGAG
701 GTTCGGTCTCAGGTTCCCCCTGAGATTGAG
703 GACAATGGGTAGAATATTTCAACTGTTGATGC
708 GTTCGGTCTCAATTTTAAACTGAGATTGAG
714 GTTCGGTCTCAATTTTAACCTGAGATTGAG
722 GTCAGCTTTGTTTCTAGGAGACTGAGCGTTCGG
724 CTTTGTCTCTAATTTTAAACTGAGATTGAG
742 CAGCTTTGTCTCTAGCTCACTGAGCGTTCGGTC
744 CAGCTTTGTCTCTAGACTGAGCGTTCGGTC
750 CGGCAATAAGGGTGGCAAAGAGGGTCGAGC
801 CCCATGCATGATCGCGATGAACGCGAAATGAAAC
897 CCCATGCATAACTCCTATTATTAACTATTAATTG
898 CCCATGCATGAACGCGAAATGAAACTTATCTAATCAC
899 CCCATGCATCACTTGTTATGTGATCAGCTTTTGAGTG
900 CCCATGCATCAGCTTTTGAGTGAAGTGGAAACGGG
925 TAGCTACTAGACAGAAAGCTTCCTAACAAGGAGATGCAC