Skip to main content

Table 2 Sets of primers used for site-directed mutagenesis in this study

From: Bacillus subtilis GlcK activity requires cysteines within a motif that discriminates microbial glucokinases into two lineages

Mutation Primer setsa
D10K 5' tgcgggcatta ag ctgggaggaacgacgat 3'
  5' aaccatatctcgtccatggatccgtgatgg 3'
C166A 5' ggccatattgc cagcatccctgaaggcgga 3'
  5' gatttctccgccggcgccatttataccatg 3'
C175A 5' gcgcccgc caactgcggcaaaacgggctgt 3'
  5' tccgccttcagggatgctgcaaatatggcc 3'
C177A 5' tgcaacgc cggcaaaacgggctgtatcgaa 3'
  5' gggcgctccgccttcagggatgctgcaaat 3'
C182A 5' ggcaaaacgggcgc tatcgaaacaattgcg 3'
  5' gcagttgcagggcgctccgccttcagggat 3'
C282A 5' cgcaaagc cgcgtttccgcgggcagcccaa 3'
  5' gaatgttttctcgacttttgatctcagcag 3'
C321A 5' catcaaaatgc ttaaaattgtgtaaatgaa 3'
  5' tttcagccattcatttttagcgatccaagc 3'
  1. a Underlined is mutated nucleotide.