Skip to main content

Table 3 List of Oligonucleotide Primers

From: Allele specific synthetic lethality between priC and dnaAts alleles at the permissive temperature of 30°C in E. coli K-12

Name 5' to 3' oligonucleotide sequence Position
prSJS283 ATATTGAGTGTTGTCAGC Upstream of priC
prSJS284 TCCTCCAGCAGCACAATC Downstream of priC
prSJS480 CCGCGGTCCCGATCGTTTTG dnaA upstream primer
prSJS481 GCAGGGCGTTGAAGGTGTGG dnaA downstream primer