Skip to main content

Advertisement

Table 1 Polymorphism "hot spots" along the 16S rRNA gene of the E. sakazakii strains analyzed in the study in correspondence to E. sakazakii type strain ATCC 29544, E. coli type strain ATCC 11775 and E. cloacae type strain ATCC13047

From: 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification

    E. sakazakii 16S rRNA gene sequence polymorphism positions1
strain Sequence accession no. source I (187–193) II (455–477) III (590–600) IV (1132–1141)
E. coli ATCC 11775 X80725   GCAAGCA GAGTAAAGTTAATACCTTTGCTC TTGTTAAGTCA CGGTCCG-GCC
E. cloacae ATCC 13047 AJ251469   GCAAGAC TGTTGTGGTTAATAACCGCAGCA CTGTCAAGTCG CGGTCCG-GCC
E. sakazakii ATCC 29544 AB004647 human TACGGAC TGTTGTGGTTAATAACCGCAGCA TGATTAAGTCA CGGTTCG-GCC
E. sakazakii ES 11 AY803187 human TWCGGAC YGYTGTGGTTAATAACCACAGCA CTGTTAAGTCA CGGTTCG-GCC
E. sakazakii ES 4 AY803186 human TWCGGAC TGYTGTGGTTAATAACCACAGCA CTGTTAAGTCA CGGTCCG-GCC
E. sakazakii FSM 266 AY803190 environment TACGGAC CGTTGTGGTTAATAACCGCAGCG CTGTTAAGTCA CGGTTCG-GCC
E. sakazkaii 1084 AY803192 fruit powder TACGGAC CGTTGTGGTTAATAACCACAGCG YKRTTAAGTCA CGGTTCG-GCC
E. sakazakii ES Vo7/24922 AY803189 human TACGGAC TGTTGTGGTTATTAACCRCAGCA YKRTTAAGTCA CGGTTCG-GCC
E. sakazakii FSM 265 AY803191 milk powder TTCGGAC CGTTGTGGTTAATAACCGCAGCG YKRTTAAGTCA CGGTTCG-GCC
E. sakazakii ATCC 51329 AY752937   GCAAGAC GGTTAAGGTTAATAACCTTGGCC CTGTCAAGTCG CACATCATGGT
E. sakazakii 858 AY752936 fruit powder TACGGAC TGTTGTGGTTAATAACCGCAGCA TGATTAAGTCA CGGTCCG-GCC
E. sakazakii 759 AY752939 fruit powder TACGGAC TGTTGTGGTTAATAACCACAGCG CTGTTAAGTCA CGGTYCG-GCC
E. sakazakii 954 AY752938 fruit powder TWCGGAC YGYTGTGGTTAATAACCACAGCR YTGTTAAGTCA CGGTYCG-GCC
E. sakazakii 236 AY752943 fruit powder TWCGGAC YGYTGTGGTTAATAACCACAGCR YKGTTAAGTCA CGGTYCG-GCC
E. sakazakii FSM 468 AY752942 environment TACGGAC YGYTGTGGTTAATAACCACAGCA YTRTTAAGTCA CGGTTCG-GCC
E. sakazakii FSM 393 AY752941 baby food TACGGAC CGTTGTGGTTAATAACCGCAGCG TKRTTAAGTCA CGGTCCG-GCC
E. sakazakii FSM 33 AY752940 milk TTCGGAC TGTTGTGGTTAATAACCACAGCA CTGTTAAGTCA CGGTTCG-GCC
  1. 1 E. coli positions according to Brosius et al. [17]