Skip to main content

Table 2 Plasmids and primers used in this study

From: Variation suggestive of horizontal gene transfer at a lipopolysaccharide (lps) biosynthetic locus in Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen of rice

Plasmids Relevant characteristics Reference or source
pUFR034 IncW Nmr Mob+ mob (P) lacZ alpha Par+ cos (8.7 kb) [44]
Pbluescript Apr Stratagene
pSD5 pUFR034 + a 35 kb insert from the BXO1 genome [8]
pBP1 pBluescript + a 2.2 kb Eco RI fragment from pSR1 This study
pBP2 pBluescript + a 3.5 kb Eco RI fragment from pSR1 This study
pBP3 pBluescript + a 4.0 kb Eco RI fragment from pSR1 This study
pBP4 pBluescript + a 9.0 kb Eco RI fragment from pSR1 This study
pBP5 pBluescript + a 10 kb Eco RI fragment from pSR1 This study
Primers specific to ORFs present in the genomic island of BXO1   
WxoA Forward primer CCAAGCGACCAGAGGTGCTTGACG  
  Reverse primer GAGGAGCACCATCCGCTACCGCCC  
WxoB Forward primer GTTTTTGTTGGTACTGGGTGCGAG  
  Reverse primer GTACGCCACGGTCAGATCGGCTGC  
WxoC Forward primer CTACTGATGTTGTTCGCAAGGTGG  
  Reverse primer GGCGACTCACCTGCATATCGAGCC  
WxoD Forward primer GTGCTGGTGAGCCATCATTTTG  
  Reverse primer TTACTCACCGGCCATAATCCTTTT  
Wzt Forward primer GACATCGCTATCGAAGTAAAAGGT  
  Reverse primer TCAGGTGCTGTTTGAAGTAGCGGAC  
Wzm Forward primer CATCGGCAAACCCCTTTCGGGT  
  Reverse primer CGCAGCTTACTGATGGAACCCT  
Primers used for TAIL PCR   
designed against metB gene sequence of BXO1   
CglL1 CTTCGACGCAGCCAAGCGTTTC  
CglL2 CTGCGAGAAGACCGAGCTGTTCAC  
CglL3 CGAATCGCTCGGTGGTGTTGAA  
designed against etfA gene sequence of BXO1   
EtfL1 TCGGCCAGACCGGCAAGATCAT  
EtfL2 AGCTGTACATGGCCATCGGCAT  
EtfL3 AGCATCTGACCGGCATCAAGGA  
Other primers described in the paper   
Pbp1 AGCGTGCTGGTGAGCCATCA  
Pbp2 GCAGCAAAAATGCTGTCATAACCA