Skip to main content

Table 2 Plasmids and primers used in this study

From: Expression of a novel gene, gluP, is essential for normal Bacillus subtilis cell division and contributes to glucose export

Plasmids Relevant characteristics Primers Reference/source
pAC6 Vector for transcriptional lacZ fusions   [41]
pLR-P01 pAC6 Eco RI Bam HI; 2117 bp 5'atgccattttcgcggtttct3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatccgtcgccggttttatctgtcg3'd  
pLR-P011 pAC6 Eco RI Bam HI; 2000 bp 5'ccggaattcgcggtaaacatgtttttgc3' this study
  Eco RI-Bam HI fragmenta 5'cgcggatccgtcgccggttttatctgtcg3'd  
pLR-P012 pAC6 Eco RI Bam HI; 1679 bp 5'ccggaattcgagaagggaactgtgtcag3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatccgtcgccggttttatctgtcg3'd  
pLR-P013 pAC6 Eco RI Bam HI; 980 bp 5'ccggaattcggacatatcggcggcttga3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatccgtcgccggttttatctgtcg3'd  
pLR-P014 pAC6 Eco RI Bam HI; 674 bp 5'ccggaattcgcgggtttcccttttggaac3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatccgtcgccggttttatctgtcg3'd  
pLR-P015 pLR-PO1 derivative Bst BI; - this study
  1313 bp fragmentb   
pLR-P02 pAC6 Eco RI Bam HI; 352 bp 5'ccggaattcgcggtaaacatgtttttgc3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatccctgacacagttcccttctc3'd  
pLR-P03 pAC6 Eco RI Bam HI; 730 bp 5'ccggaattcgagaagggaactgtgtcag3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatcctcaagccgccgatatgtcc3'd  
pLR-P04 pAC6 Eco RI Bam HI; 346 bp 5'ccggaattcggacatatcggcggcttga3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatccgttccaaaagggaaaccgc3'd  
pLR-P021 pAC6 Eco RI Bam HI; 469 bp 5'atgccattttcgcggtttct3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatccctgacacagttcccttctc3'd  
pLR-P031 pAC6 Eco RI Bam HI; 1168 bp 5'atgccattttcgcggtttct3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatcctcaagccgccgatatgtcc3'd  
pLR-P032 pAC6 Eco RI Bam HI; 1051 bp 5'ccggaattcgcggtaaacatgtttttgc3'c this study
  Eco RI-Bam HI fragmenta 5'cgcggatcctcaagccgccgatatgtcc3'd  
pLR-YqgP pRK415 Bam HI Kpn I; 1877- 5'cgcggatcgcgcggtttctgccgtcatgt3'c this study
  bpBam HI Kpn I fragmenta 5'cggggtacctttcctcaccatttcttg3'd  
pLM-YqgP-Km1 pLR-YqgP derivative; gluP::aphA3 Kmr - this study
pRK415 Tcr, low-copy number plasmid   [46]
  1. aSize of the cloned PCR fragment after digestion with restriction enzyme as indicated bThe deletion within the 2112 bp DNA fragment of the pLR-P01, which is digested by Bst BI and religated fForward primer; dReverse primer