Skip to main content

Table 1 Sequences and predicted lengths of PCR amplification products of oligonucleotide primers used

From: First isolation and further characterization of enteropathogenic Escherichia coli (EPEC) O157:H45 strains from cattle

Target Primer Oligonucleotide sequence (5'-3')Sequence Product size Reference
stx VT1 ATTGAGCAAAATAATTTATAT GTG 523 bp 21
  VT2 TGATGATGGCAATTCAGTAT 520 bp  
eae SK1 CCCGAATTCCGCACAAGCATAAGC 863 bp 22
  SK2 CCCGGATCCGTCTCGCCAGTATTCG   
eae-α1 EAE-FB AAAACCGCGGAGATGACTTC 820 bp 7
  EAE-A CACTCTTCGCATCTTGAGCT   
eae-α2 IH2498aF AGACCTTAGGTACATTAAGTAAGC 517 bp 7
  IH2498aR TCCTGAGAAGAGGGTAATC   
eae-β1 EA-B1-F CGCCACTTAATGCCAGCG 811 bp 7
  EAE-B CTTGATACACCTGATGACTGT   
eae-β2 EA-B2-F CCCGCCACTTAATCGCACGT 807 bp 7
  EAE-B CTTGATACACCTGATGACTGT   
eae-γ1 EAE-FB AAAACCGCGGAGATGACTTC 804 bp 7
  EAE-C1 AGAACGCTGCTCACTAGATGTC   
eae-γ2/θ EAE-FB AAAACCGCGGAGATGACTTC 808 bp 7
  EAE-C2 CTGATATTTTATCAGCTTCA   
eae-δ/κ EAE-FB AAAACCGCGGAGATGACTTC 833 bp 7
  EAE-D CTTGATACACCCGATGGTAAC   
eae EAE-FB AAAACCGCGGAGATGACTTC 722 bp 7
  LP5 AGCTCACTCGTAGATGACGGCAAGCG   
eae Z1 GGTAAGCCGTTATCTGCC 206 bp 7
  Z2 ATAGCAAGTGGGGTGAAG   
eae EAE-FB AAAACCGCGGAGATGACTTC 712 bp 7
  LP8 TAGATGACGGTAAGCGAC   
eae EAE-FB AAAACCGCGGAGATGACTTC 807 bp 7
  LP7 TTTATCCTGCTCCGTTTGCT   
eae 68.4F CGGTCAGCCTGTGAAGGGC 466 bp 7
  68.4R ATAGATGCCTCTTCCGGTATT   
eae FV373F CAACGGTAAGTCTCAGACAC 443 bp 7
  FV373R CATAATAAGCTTTTTGGCCTACC   
eae IH1229aF CACAGCTTACAATTGATAACA 311 bp 7
  IH1229aR CTCACTATAAGTCATACGACT   
eae EAE-FB AAAACCGCGGAGATGACTTC 468 bp 7
  B49R ACCACCTTTAGCAGTCAATTTG   
ehxA HlyA1 GGTGCAGCAGAAAAAGTTGTAG 1551 bp 23
  HlyA2 TCTCGCCTGATAGTGTTTGGTA   
ast A EAST1 CCA TCA ACA CAG TAT ATC CGA 111 bp 24
  EAST2 GGT CGC GAG TGA CGG CTT TGT   
EAF EAF1 CAG GGT AAA AGA AAG ATG ATA A 397 bp 25
  EAF25 TAT GGG GAC CAT GTA TTA TCA   
bfpA EP1 AAT GGT GCT TGC GCT TGC TGC 326 bp 26
  EP2 GCC GCT TTA TCC AAC CTG GTA