Skip to main content

Table 2 Potential ModE-binding sites identified by scanning archaeal genome sequences against the weight matrix derived from alignment in Figure 3. Sites that fall immediately upstream of genes implicated in molybdenum metabolism are indicated in bold. Scores are Kullback-Leibler distances that have been normalised such that the maximum possible score is 100. Essentially, the higher the score is, the greater the magnitude of the theoretical binding energy [26]. All sites scoring more than 75 are listed. Distances are given (number of bases) between the downstream end of the putative ModE-binding site and the predicted translational start codon.

From: A DNA element recognised by the molybdenum-responsive transcription factor ModE is conserved in Proteobacteria, green sulphur bacteria and Archaea

Organism Sequence Score Distance Annotation of potential target gene
Methanosarcina mazei TGGCGTTATGTTTATTTAAACATAACGAT 80 -5 MM1564 molybdenum containing formylmethanofuran dehydrogenase isoenzyme I subunit E
Methanosarcina mazei TAATGTTATATATCTTAATAAATAACTTT 78 524 MM1328 Two component response regulator
Methanosarcina mazei TAACGATATATTAATAATTAGATTTAGAT 78 299 MM1783 hypothetical protein
Methanosarcina mazei TATCCATATACTAATGATTATATATCCAT 78 69 MM1790 conserved protein
Methanosarcina mazei AATATTTATATAGTACACAATATATCAAT 78 39 MM2248 conserved protein
Methanosarcina mazei CACCCATATATTAGTTTATAAATAACGCT 78 948 MM2931 hydrolase
Methanosarcina mazei GAAGCGTATATATAAGAGTATATAAAGAG 78 53 MM3131 Fructokinase
Methanosarcina mazei TTTCTCTCTATACTAGTCTACAGATAGAG 78 191 MM3331 conserved protein
Methanosarcina mazei GAACAATATATCGTTAACAATATATCCAT 77 48 MM0378 sugar phosphate nucleotydyl transferase
Methanosarcina mazei AATCTTTATATCATGGAATTTATCGTGAA 77 290 MM0957 Ammonium transporter
Methanosarcina mazei CATCTTTTTATACTTCCCTATATACTTAA 77 31 tlpC MM1658 methyl accepting chemotaxis protein
Methanosarcina mazei AAAACATATATAGAAACATACATATCGCA 77 153 MM2159 hypothetical protein
Methanosarcina mazei TCTCGTTATATTTCTATTTATATATATTT 77 344 MM2777 Acylphosphatase
Methanosarcina mazei TTTCGCTGTATATCTTATTTCATAAATAG 76 1436 MM0016 translation initiation factor 1A
Methanosarcina mazei TGACAGTATATAAATTAATAGTTAGAGAT 76 76 MM0211 Cysteine proteinase
Methanosarcina mazei AGTCATTATCTATATCAATATAAATAGTT 76 527 MM0338 putative phosphomethylpyrimidine kinase
Methanosarcina mazei AAACATTAAATATTTTAATACATAGTTAT 76 39 MM0659 GDP mannose 4,6 dehydratase
Methanosarcina mazei ATTAGGTTTATAAGTCAATAAATAATGAA 76 43 MM0996 cobalamin biosynthesis protein G
Methanosarcina mazei TTTAGATTTATATAAGAATTTAAAACTAT 76 276 MM1157 conserved protein
Methanosarcina mazei TATCGGGATATTCTATGGATTATATCGAA 76 13 MM1281 conserved protein
Methanosarcina mazei AAACGTTATATACAAGCGAATATGAGTAT 76 156 MM1355 conserved protein
Methanosarcina mazei CATCAATAAATTAATTTCTATATAAGGTA 76 30 MM1847 hypothetical protein
Methanosarcina mazei GATTGATATATAATTATTTTCAAACTGAT 76 25 iorA MM2093 Indolepyruvate oxidoreductase, subunit
Methanosarcina mazei AATTAATATATGATGGATTTTATATAGAT 76 290 MM2747 hypothetical protein
Methanosarcina mazei TAAATATATATAAATAGAAATATAACGAG 76 101 MM2776 hypothetical protein
Methanosarcina mazei AAGCGTTATTTATAAACTAATATATGGGT 76 35 MM2932 conserved protein
Methanosarcina mazei AATCGCTCTATAGAAGTAAACTGAGCGGA 76 377 MM2945 Mannosyltransferase
Methanosarcina mazei AAACTTTATATATTAAAATATAAATAAAA 76 499 MM3203 hypothetical protein
Methanosarcina acetivorans TATGGTTATGTAATTCTAAACATAACGAA 81 1504 vnfH MA1213 nitrogenase (iron protein)
Methanosarcina acetivorans AATCGTTATGTTTAGGTATACATAACTAC 81 164 modA MA2280 molybdenum ABC transporter, solute binding protein
Methanosarcina acetivorans TAAAGTTATTTATTAGTATACATAACTAT 80 764 cheY2 MA0016 chemotaxis response regulator
Methanosarcina acetivorans AAATGAAATATATATATATAGATAACGAT 80 185 MA0724 predicted protein
Methanosarcina acetivorans TTTCAATATATATTTCAATATATAAAATA 80 378 vhtG MA1146 F420 nonreducing hydrogenase
Methanosarcina acetivorans ATTCGTTATGTTTAGAATTACATAACCAT 80 339 nifI1 MA1212 P II family nitrogen regulatory protein
Methanosarcina acetivorans AATCTGTATATAATTAACCAGATAGAGTT 80 9 MA2899 conserved hypothetical protein
Methanosarcina acetivorans TGTCGTTATGTTTATTTAAACATAACGGT 79 -6 fmdE MA0304 formylmethanofuran dehydrogenase, subunit E
Methanosarcina acetivorans CACCGTTATGTTTAAATAAACATAACGAC 79 1483 MA0303 conserved hypothetical protein
Methanosarcina acetivorans ATTAATTATATAAATGTGTATATAAATAT 79 1375 hypC MA1140 hydrogenase expression/formation protein
Methanosarcina acetivorans GAACCTTATATATTTTTCTACAGAGAGCT 79 114 MA3892 hypothetical protein (multi domain)
Methanosarcina acetivorans AGTGGCTATATTTAGCTATATATAACAAA 79 710 MA3957 ABC transporter, ATP binding protein
Methanosarcina acetivorans ACTCGATATATTATTCAACGAATAGTGAT 78 118 MA1301 predicted protein
Methanosarcina acetivorans ATCCGTTATGTATGAATGAACATAACGTT 78 27 MA1663 predicted protein
Methanosarcina acetivorans TATCTTTATGTTTATCCGAACATATCGAT 78 6 MA4536 ABC transporter, solute binding protein
Methanosarcina acetivorans ATTTACTTTATATCTGTATATATATTGAA 77 529 MA0519 conserved hypothetical protein
Methanosarcina acetivorans TATCGTTATCTATATATATATATTTCATT 77 114 MA0725 conserved hypothetical protein
Methanosarcina acetivorans CTATTTTATATATTGAAATATATATTGAA 77 122 MA1145 hypothetical protein (multi domain)
Methanosarcina acetivorans GTTCCTTTTATATTGCAAATCATAACGTT 77 43 MA2861 response regulator receiver
Methanosarcina acetivorans AAACGTTATATACAAGCGGATATGAGTAT 76 147 MA0056 conserved hypothetical protein
Methanosarcina acetivorans AATTCTTTTATATAAATCCATATAACGGT 76 130 MA0459 conserved hypothetical protein
Methanosarcina acetivorans TACCGTTATATGGATTTATATAAAAGAAT 76 229 MA0458 predicted protein
Methanosarcina acetivorans CTAGGTTATATAACAGAAATCATAAAGAG 76 17 MA1630 sensory transduction histidine kinase
Methanosarcina acetivorans TTACGATATATATAAATTTATCTAAAAAA 76 87 MA1757 conserved hypothetical protein
Methanosarcina acetivorans ATTTTTTAGATAAATTTATATATATCGTA 76 441 MA1756 cell surface protein
Methanosarcina acetivorans ATCCATTAGATACAAATATTTATATAGAA 76 1467 MA3192 conserved hypothetical protein
Methanosarcina acetivorans TATATTTATATAAAAATCAACATATCTAT 76 555 cpa MA3604 carboxypeptidase A
Methanosarcina acetivorans GTACAGTATATATTTTAAAATATAGTTAT 76 507 atpH MA4152 H(+) transporting ATP synthase, subunit H