Skip to main content

Table 1 Primer sequences for sequencing of mer A genes and for merA-TGGE.

From: Functional profiling of mercuric reductase (mer A) genes in biofilm communities of a technical scale biocatalyzer

mer primers Direction Nucleotide sequence (5' to 3')
primers used for sequencing
T1 Forward GTCTGGATCGGCAACTTGA
P1 Forward GGCTATCCGTCCAGCGTCAA
A1 Forward ACCATCGGCGGCACCTGCGT
A5 Reverse ACCATCGTCAGGTAGGGGACCAA
A7 Reverse TGGCGCATTGACAGTBGACCC
A9 Forward GAAYTGGATCCAGACGGCKG
A10 Reverse GATCATGATCTTGGACGGCACACA
D1 Reverse TCATGGCAAACTCTCCGC
TGGE primers (GC-clamp in italics)
GC-merAf Forward CCCGCCGCCCCGCCCGCCGCCCCGCCCCGCCGCCCGCC TTGGAGAACGTGC
merAr Reverse ACGTCCTTGGTGAAGGTCTG