Skip to main content

Table 3 Oligonucleotide primer pairs used for PCR and sequencing in this study.

From: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae

ORFa Region amplified a 5'-3' sequence of primers
Cpn 007 7488–8694 AAGAGTTTTCGCTAT TGACGACTCTTAGATGTTTCG
Cpn 010 13152–13502 GAAAACACCTCTTGTGGCTAG AGACATACCCACGGAATAATAAA
Cpn 010 13175–14431 TACTCGCGAGGACCATACCTAGC AACTCATGGAACGTTATCTCGTCC
Cpn 010.1 15178–16324 GCTTGGATGATTTACGACGAG CTAAGATTTTTTGGGTGGCACG
Cpn 041 55728–56987 GAAAATTCTTTTCGCAGAGATGGA TCCTGTGCTCTTCATAACGCTCAC
Cpn 043 58069–59173 TGCTTTTCAGGCATTCCAGG GCGAGCTACGACCTCTTTAGCGA
Cpn 045 60755–61856 ATTTGAATCGATGGAGATTCCAGA TATCCTGCAGCCATTCTACATCTT
Cpn 1054 1206885–1208142 AAAGGAAGTTTTCTTGAAGATCTT ACTCATGGAACGTTATCTCGTCC
Cpn 1055 1209382–1210530 AGTTCCTGAGATTCCTGAGGC TATCTCCTCAACTACTCGAGATAAC
  1. Open Reading Frame (ORF) designations and region amplified are relative to the numbering in the CWL029 genome sequence available through reference [7].