Skip to main content

Advertisement

Table 2 Set of primers for MLVA analysis

From: High resolution, on-line identification of strains from the Mycobacterium tuberculosis complex based on tandem repeat typing

Locus name forward primer reverse primer
H37Rv_0024_18 bp GAGAAACAGGAGGGCGTTG TATTACGACGACCGCTATGC
H37Rv_0079_9 bp CGTGCACAGTTGGGTGTTTA TTCGTTCAGGAACTCCAAGG
H37Rv_0154_53 bp TGGACTTGCAGCAATGGACCAACT TACTCGGACGCCGGCTCAAAAT
H37Rv_0424_51 bp GTCCAGGTTGCAAGAGATGG GGCATCCTCAACAACGGTAG
H37Rv_0531_15 bp GGTTACCACTTCGATGCGTCTGCG AGCCGCCGAAACCCATC
H37Rv_0577_58 bp* GACTTCAATGCGTTGTTGGA* GTCTTGACCTCCACGAGTGC*
H37Rv_0580_77 bp CAGGTCACAACGAGAGGAAGAGC GCGGATCGGCCAGCGACTCCTC
H37Rv_0802_54 bp* AAGCGCAAGAGCACCAAG* GTGGGCTTGTACTTGCGAAT*
H37Rv_0959_53 bp GTTCTTGACCAACTGCAGTCGTCC GCCACCTTGGTGATCAGCTACCT
H37Rv_1121_15 bp CTCCCACACCCAGGACAC CGGCCTACCCAACATTCC
H37Rv_1443_56 bp GGTAATCCTGGTCGCTTGTC ACCCAAATTGCCCTGGTC
H37Rv_1451_57 bp GGTAGCCGTCGTCGAGAAGC CGCCACCACCGCACTGGC
H37Rv_1612_21 bp GCTGCACCGGTGCCCATC CACCGGAGCCGGAACGGC
H37Rv_1644_53 bp TCGGTGATCGGGTCCAGTCCAAGTA CCCGTCGTGCAGCCCTGGTAC
H37Rv_1895_57 bp GGTGCACGGCCTCGGCTCC AAGCCCCGCCGCCAATCAA
H37Rv_1955_57 bp AGATCCCAGTTGTCGTCGTC CAACATCGCCTGGTTCTGTA
H37Rv_1982_78 bp* ATCGTCAGCTGCGGAATAGT* AATACCGGGGATATCGGTTC*
H37Rv_2059_77 bp TCGGAGAGATGCCCTTCGAGTTAG GGAGACCGCGACCAGGTACTTGTA
H37Rv_2074_56 bp AAATTCAAAGAGTTTCTCGACAGTG GATCTTGAGAACCAAGATGTCCTT
H37Rv_2163_a_69 bp CCCATCCCGCTTAGCACATTCGTA TTCAGGGGGGATCCGGGA
H37Rv_2163_b_69 bp CGTAAGGGGGATGCGGGAAATAGG CGAAGTGAATGGTGGCAT
H37Rv_2165_75pb* ATTTCGATCGGGATGTTGAT* TCGGTCCCATCACCTTCTTA*
H37Rv_2347_57 bp AACCCATGTCAGCCAGGTTA ATGATGGCACACCGAAGAAC
H37Rv_2401_58 bp AGTCACCTTTCCTACCACTCGTAAC ATTAGTAGGGCACTAGCACCTCAAG
H37Rv_2461_57 bp GCGAACACCAGGACAGCATCATG GGCATGCCGGTGATCGAGTGG
H37Rv_2531_53 bp CAGCGAAACGAACTGTGCTATCAC CGTGTCCGAGCAGAAAAGGGTAT
H37RV_2387_54 bp CGACCAAGATGTGCAGGAATACAT GGGCGAGTTGAGCTCACAGAA
H37Rv_2990_55 bp GTGACGTTTACCGTGCTCTATTTC GTCGTCGGACAGTTCTAGCTTT
H37Rv_2996_51 bp CCCGCCTTCGAAACGTCGCT TGGACATAGGCGACCAGGCGAATA
H37Rv_3006_53 bp TCGAAAGCCTCTGCGTGCCAGTAA GCGATGTGAGCGTGCCACTCAA
H37Rv_3171_54 bp GCAGATAACCCGCAGGAATA GGAGAGGATACGTGGATTTGAG
H37Rv_3192_53 bp* ACTGATTGGCTTCATACGGCTTTA* GTGCCGACGTGGTCTTGAT*
H37Rv_3232_56 bp CAGACCCGGCGTCATCAAC CCAAGGGCGGCATTGTGTT
H37Rv_3239_79 bp CTCGGTGATGGTCCGGCCGGTCAC GGAAGTGCTCGACAACGCCATGCC
H37Rv_3336_59 bp ATCCCCGCGGTACCCATC GCCAGCGGTGTCGACTATCC
H37Rv_3663_63 bp GCCCAAAAAGCATGGGAACGTGCCCCT GGTTGTCCCCGCAGTATCTC
H37Rv_3690_58 bp AATCACGGTAACTTGGGTTGTTT GATGCATGTTCGACCCGTAG
H37Rv_4052_111 bp AACGCTCAGCTGTCGGAT GGCCAGGTCCTTCCCGAT
H37Rv_4156_59 bp* TGGTCGCTACGCATCGTGTCGGCCCGT* TACCACCCGGGCAGTTTAC*
H37Rv_4348_53 bp CGCATCGACAAACTGGAGCCAAAC CGGAAACGTCTACGCCCCACACAT
  1. * : the primers indicated are not the primers used in the princeps publication, but were designed for the present study, usually in order to reduce the size of the PCR product and consequently to improve allele size identification.