Skip to main content

Table 2 Selected group-specific probes

From: Bacterial discrimination by means of a universal array approach mediated by LDR (ligase detection reaction)

GROUP DISCRIMINATING OLIGO (5'–3') COMMON PROBE (5'–3')a cZIP code ZIP number
actinomycetes TTGTACACACCGCCCGTCACGT CAIGAAAGTCGGIAACACCCGAAGGGTCAGGTTACCGCTGCGATCGCA 21
bacilli ACTCCTACGGGAGGCAGCAGTA GGGAATCTTCCICAATGGACGAAAGGCTGCGATCGATGGTCAGGTGCTG 3
cyanobacteria ACGAAAGCTAGGGGAGCGAAAG GGATTAGATACCCCTGTAGTCCTAGCCCGCAAGGTAGGTGCTGTACCCGCA 11
myxobacteria GCGGAATTCCCIIIGTAGAGGTGAAATT CGTAGATATIGGGAGGAACACCGGTGCTGTACCCGATCGCAAGGTGGTC 5
pseudomonads GAGCTAATCCCAIAAAACCGATCGT AGTCCGGATCGCAGTCTGCACGCATACCAGGTCGCATACCGGTC 15
UNIVERSAL GCATGGITGTCGTCAGCTCGT GTCGTGAGATGTTGGGTTAAGTCCCCGCACGATAGGTGGTCTACCGCTG 13
  1. a cZip codes are indicated in bold type.