Skip to main content

Table 4 PCR primers and conditions used in this study

From: Molecular characterization of cytolethal distending toxin gene-positive Escherichia coli from healthy cattle and swine in Nara, Japan

    PCR conditions Amplicon
Primer Sequence (5′-3′) Target Denaturing Annealing Extension (bp) Reference
Cdt-Bcomu TAAATGGAATATACATGTCCG cdt-IB?~?VB 94°C, 30 s 50°C, 30 s 72°C, 60 s 588 [10]
Cdt-Bcomd TTTCCAGCTACTGCATAATC       
Cdt-IIIAf GTAGGCATTCTTATTCCA cdt-IIIABC 94°C, 30 s 50°C, 30 s 72°C, 90 s 1,909 [10]
Cdt-IIICr AGTTTTCTTATCTGTCGG       
CdtIII/VB-F CAGAAGGACTCAGATGTC       
CdtIIIC-R TGGTTGTTTGAGGTCAGT cdt-IIIBC 94°C, 30 s 55°C, 30 s 72°C, 60 s 546 this study
CdtVC-R GCTCTGTGGTACAACTTC cdt-VBC 94°C, 30 s 55°C, 30 s 72°C, 60 s 537 this study
pVir-u TCATGTGGAATAACTAGC cdt-IIIABC 94°C, 30 s 52°C, 30 s 72°C, 120 s 2,818 this study
pVir-d GTTCTGAACTTCACCAG       
EaeA-f AAACAGGTGAAACTGTTGCC eaeA 94°C, 30 s 50°C, 30 s 72°C, 60 s 454 [10]
EaeA-r CTCTGCAGATTAACCCTCTGC       
BfpA-f AATGGTGCTTGCGCTTGCTGC bfpA 94°C, 60 s 56°C, 90 s 72°C, 90 s 324 [10]
BfpA-r GCCGCTTTATCCAACCTGGTA       
EAF-f CAGGGTAAAAGAAGATGATAA EAF 94°C, 60 s 60°C, 90 s 72°C, 90 s 397 [10]
EAF-r TATGGGGACCATGTATTATCA       
Est-f ATTTTTMTTTCTGTATTRTCTT est 94°C, 30 s 50°C, 30 s 72°C, 60 s 190 [10]
Est-r CACCCGGTACARGCAGGATT       
Elt-f GGCGACAGATTATACCGTGC elt 94°C, 30 s 54°C, 30 s 72°C, 60 s 450 [10]
Elt-r CGGTCTCTATATTCCCTGTT       
AstA-f CACAGTATATCCGAAGGC astA 94°C, 60 s 53°C, 60 s 72°C, 60 s 94 [10]
AstA-r CGAGTGACGGCTTTGTAG       
Eagg-f CTGGCGAAAGACTGTATCAT aggR 94°C, 60 s 53°C, 60 s 72°C, 60 s 630 [10]
Eagg-r CAATGTATAGAAATCCGCTGTT       
EVT1 CAACACTGGATGATCTCAG stx1 94°C, 30 s 55°C, 30 s 72°C, 60 s 349 [10]
EVT2 CCCCCTCAACTGCTAATA       
EVS1 ATCAGTCGTCACTCACTGGT stx2 94°C, 30 s 55°C, 30 s 72°C, 60 s 110 [10]
EVC2 CTGCTGTCACAGTGACAAA       
CNF1-f GGGGGAAGTACAGAAGAATTA cnf1 94°C, 60 s 55°C, 60 s 72°C, 60 s 1,112 [10]
CNF1-r TTGCCGTCCACTCTCACCAGT       
CNF2-f TATCATACGGCAGGAGGAAGCACC cnf2 94°C, 60 s 55°C, 60 s 72°C, 60 s 1,241 [10]
CNF2-r GTCACAATAGACAATAATTTTCCG       
InvE-f AGTTCTCGGATGCTATGCTC invE 94°C, 30 s 60°C, 30 s 72°C, 60 s 293 [10]
InvE-r CAAGATTTAACCTTCGTCAACC       
Saa-f ACCTTCATGGCAACGAG saa 94°C, 30 s 57°C, 30 s 72°C, 60 s 1,504 [23]
Saa-r AATGGACATGCCTGTGG       
Iha-f GAAATCAGCATCCGAGG iha 94°C, 30 s 55°C, 30 s 72°C, 60 s 410 [23]
Iha-r ATACGCGTGGCTGCTG       
Efa1-f GTCAAAGGTGTTACAGAG efa1 94°C, 30 s 55°C, 30 s 72°C, 60 s 640 [23]
Efa1-r ATTCCATCCATCAGGCC       
LpfAO113-f ACTTGTGAAGTTACCTCC lpfAO113 94°C, 30 s 55°C, 30 s 72°C, 60 s 360 [23]
LpfAO113-r CGGTATAAGCAGAGTCG       
EhaA-f AGGCATGAGACACGATC ehaA 94°C, 30 s 55°C, 30 s 72°C, 60 s 500 [23]
EhaA-r AAGTCGTGCCATTGAGC       
SubA-f GTACGGACTAACAGGGAACTG subA 94°C, 30 s 55°C, 30 s 72°C, 60 s 1,264 [22]
SubA-r ATCGTCATATGCACCTCCG       
SubB-f GTAGATAAAGTGACAGAAGGG subB 94°C, 30 s 55°C, 30 s 72°C, 60 s 715 [22]
SubB-r GCAAAAGCCTTCGTGTAGTC       
P2-A2 CACTGACAACGGCTGAAC Upstream 94°C, 30 s 55°C, 30 s 72°C, 60 s 848 [18]
cdtA-F AAATGGGGAGCAGGATAC of cdt-VA      
cdtC-F GAACCCCAAATACAGACC Downstream 94°C, 30 s 55°C, 30 s 72°C, 60 s 712 [18]
P2-C3 TGGTTGATGACGGTGTTA of cdt-VC      
eae-F AGGATATTCTTTCTCTGAATA eaeA 94°C, 30 s 55°C, 30 s 72°C, 60 s 1,300 [33]
eae-R ATATYTATTTGCWGSVCCCCAT