Skip to main content

Table 4 Sequences of primers used for the Las -LAMP assay

From: Rapid and sensitive detection of Candidatus Liberibacter asiaticus by loop mediated isothermal amplification combined with a lateral flow dipstick

Primer name Type Sequence (5′-3′) Length
Las-F3 F3 GCCCTATATCTCGTGTCAT 19 mer
Las-B3 B3 ATTCCTTCCTCGTAAACGT 19 mer
Las-FIP FIP (F1c + F2) CACAACTGATTCCAAGGATAGCT- 44 mer
ATAATTATCAGGTGCATCGGA
Las-BIP BIP (B1c + B2) GCCAGGCAGTGATTCATCGTAG- 39 mer
ATAGCGAATTCCCCCCA
Las-LF LF GATCGACTCAGCCATGATTTACAA 24 mer
Las-LB LB TGACGAAGATTATCCTCAACATCG 24 mer