Skip to main content

Table 2 The sequences of the primers used for gene expression

From: Zearalenone lactonohydrolase activity in Hypocreales and its evolutionary relationships within the epoxide hydrolase subset of a/b-hydrolases

Primer Sequences (5′-3′)
LACDP723R CAAACGTAGTGACCCTGAAGC
LACDP652F CTCGGAGAATGCCAGATGTT
rtBtubTRICHOR2 AGCGAATCCGACCATGAAGA
rtBtubTRICHOF2 CACCGTCGTTGAGCCCTA