Skip to main content

Table 1 Sequences of the primers used for amplification and sequencing

From: Zearalenone lactonohydrolase activity in Hypocreales and its evolutionary relationships within the epoxide hydrolase subset of a/b-hydrolases

Primer name Sequences (5′-3′) Estimated product length
LacDP26F GAGCCAAGAGAGACCCACAG  
LacDP347R TTATGTCCGAATGTCGTTGA 321
LacDP326F GTTCAACGACATTCGGACAT  
LacDP712R AACGTAGTGACCCTGAAGCC 386
LacDP693F GGCTTCAGGGTCACTACGTT  
LacDP903R GTATCCTGTCGGGGTAACCG 210
LacDP886F GTTACCCCGACAGGATACGC  
LacDP1208R GAAAGACTCGGTTGGTGTCG 322
LacDP1188F GCGACACCAACCGAGTCTTT  
LacDP1400R TACAATATCGCCTGCCCTCT 212
LacDP1380F GAGAGGGCAGGCGATATTGT  
LacDP1695R GGGAGCGAGTCAACAACCTA 315
LacDP1661F AATCTCCGCCATGCTTAGG  
LacDP1990R GGCTGGTCTCCCGTACAAT 329