Skip to main content

Table 3 List of oligonucleotides used

From: Characterization of two transketolases encoded on the chromosome and the plasmid pBM19 of the facultative ribulose monophosphate cycle methylotroph Bacillus methanolicus

Name Sequence (5’-3’)
pET16b_Fw GCTAACGCAGTCAGGCACCGTGTA
pET16b_Rv GACTCACTATAGGGGAATTGTGAGCG
tktC_Fw_XhoI CCGGCTCGAG TTG TTTGATAAAATTGACCAT
tktC_Rv_XhoI CCGGCTCGAG TTA TTGTTTAAGTAAAGCT
tktP_Fw_XhoI GCGCCTCGAG GTG CTCCAACAAAAAATAGAT CG
tktP_Rv_XhoI GGCGCTCGAG TTA GAGAAGCTTTTTAAAATGAGAAA
tkt_C_Seq1 GCGTCATTTGGCAGCGGTATATAAT
tkt_C_Seq2 TCTAGGTCCTGAAGAACGAAAGC
tkt_C_Seq3 GGCTCGGCAGATCTTGCTAGTTC
tkt_P_Seq1 CCCTCATACGCTTTTTCAGAATC
tkt_P_Seq2 GCTAGAGCATTTAACACTGCACC
tkt_P_Seq3 CGATCTTGAACACTCTCACTAAATG
gapb_fw GCGACTCGAG ATG ACCGTACGCGTAGCGATAA
gapb_rv GCGTCTCGAG TTA CCTGAAAGCAACAGTAGC
  1. Restriction sites are highlighted in italics, stop and start codons are underlined.