Skip to main content

Table 1 Primer sequences used for the qRT-PCR

From: Cigarette smoke condensate increases C. albicans adhesion, growth, biofilm formation, and EAP1, HWP1 and SAP2 gene expression

Gene Primer sequence 5′ to 3′ Amp size (bp)
ACT1 Forward: GCTGGTAGAGACTTGACCAACCA 87
Reverse: GACAATTTCTCTTTCAGCACTAGTAGTGA
EAP1 Forward: CTGCTCACTCAACTTCAATTGTCG 51
Reverse: GAACACATCCACCTTCGGGA
HWP1 Forward: GCTCAACTTATTGCTATCGCTTATTACA 67
Reverse: GACCGTCTACCTGTGGGACAGT
SAP2 Forward: TCCTGATGTTAATGTTGATTGTCAAG 82
  Reverse: TGGATCATATGTCCCCTTTTGTT