Skip to main content

Table 1 Bacterial strains, plasmids and primers

From: Characterization of Rhizobium grahamii extrachromosomal replicons and their transfer among rhizobia

Strain Relevant characteristics Source
Rhizobia   
R. grahamii CCGE502 Wild type strain [10]
R. mesoamericanum CCGE501 Wild type strain [10]
R. mesoamericanum CCGE501-1 mini-Tn5 SmR/SpR This work
R. grahamii CCGE502a:GFP CCGE502 carrying a Gm: GFP cassette at pRgrCCGE502a This work
R. grahamii CCGE502b:Km CCGE502 carrying pK18mob:sacB at This work
R. grahamii CCGE502ΔtraI CCGE502 carrying a deletion of traI. This work
R. grahamii CCGE502ΔtraI::nodC CCGE502ΔtraI with pG18mob2 inserted at nodC This work
R. etli CFN2001 CFN42 derivative (pRetCFN42a-pRetCFN42d-) [25]
S. fredii GR64-4 GR64 cured of pSfrGR64a and pSfGRr64b, RifR [26]
S. meliloti SmA818R 2011 cured of pSymA, RifR [27]
R. phaseoli Ch24-10 Tn5mob, NeoR Rosenblueth, M, unpublished
Rhizobium sp. LPU83 SmR [27]
R. endophyticum CCGE2052 Endophyte of P. vulgaris [11]
Agrobacterium   
GMI9023 C-58 cured of its native plasmids [28]
GMI9023 (pRgrCCGE502a:GFP) GMI9023 carrying pRgrCCGE502a with a Gm-GFP cassette This work
GMI9023 (pRgrCCGE502b:Km) GMI9023 carrying pRgrCCGE502b with a pK18mob:sacB insertion This work
GMI9023 (pRgrCCGE502a:GFP, pRgrCCGE502b:Km) GMI9023 carrying pRgrCCGE502a with a Gm: GFP cassette and pRgrCCGE502b with a pK18mob:sacB insertion This work
GMI 9023 (SpR) GMI9023 with a mTn5SSgusA40 This work
GMI 9023(pRgrCCGE502a:GFP, pBBR1MCS2::traI) GMI9023 carrying pRgrCCGE502a with a Gm-GFP cassette and pBBR1MCS2::traI overexpressing AHLs of R. grahamii This work
Escherichia coli   
DH5α Recipient for transformation, sup E44 Δlac U169 ϕ80lacΔ ZM15) hsd R17 rec A1 end A1 gyr A96 thi-1 rel A1 [29]
S17-1 E. coli 294 RP4-2-Tc::Mu-Km::Tn7 integrated into the chromosome [30]
Plasmids   
pG18mob2 Cloning vector, GmR [31]
pK18mob:sacB Cloning vector, KmR, sacB [32]
pRK2013 ColE1 replicon, tra + de RK2, KmR [33]
pCAM140 pUT/mini-Tn5 SmR/SpR [34]
pMJAM01 A fragment of RGCCGE502_32801 cloned at Sma I in pK18mob:sacB This work
pMJAM02 Not I cassette carrying Gm-GFP was cloned at pMJAM01 This work
pMJAM03 Fragment 1 of RGCCGE502_33766 cloned at Sma I in pK18mob:sacB This work
pMJAM04 Fragment 2 of RGCCGE502_33766 cloned at BamH I-Hind III of pMJAM03 This work
pMJAM05 A nodC fragment cloned at Sma I pG18mob2 This work
pMJAM06 An intergenic region of pRgrCCGE502b cloned at Sma I in pK18mob:sacB This work
pRgrCCGE502a-GFP pRgrCCGE502a carrying a Gm-GFP cassette This work
pRgrCCGE502b-Km pRgrCCGE502b carrying pK18mob:sacB This work
Primers Sequence 5′ 3′  
M13 Fw GTAAACGACGGCCAGT  
M13 Rv GCGGATAACAATTTCACACAGG  
Fw_32801 GGGACACGCAGTCACCTTAG This work
Rv_32801 GACGGGGAGCAAAGTTCAT This work
Fw_ext_32801 GGACTATCTCGCCCTGACAA This work
Rv_ext_32801 AAATCGCTGACAATCCCAAG This work
Fw_33766_1 CGTTCCCGATCTGTTTATCTG This work
Rv_33766_1 CACGGAGCTGATGATGGTT This work
Fw_33766_2 AAAAAGGATCC CAGAAGGTCGGCGTAACAA This work
Rv_33766_2 AAAAAAAAGCTT CCAGCCGTTCGATGAAGA This work
Fw_ext_traI GACGTGAATTTTCGCAGGA This work
Rv_ext_traI ATGGTGAAGGCGGGTTTAG This work
Fw_nodC ACACGGCTAATTGACATGGA This work
Rv_nodC CGAAAACCTGCCTTCAACA This work
Fw_ext_nodB CGCCAACCACACTATGACAC This work
Rv_ext_nodC GGGGACTTCTTGACTGTGGA This work
Fw_28753 GATGCCTCCCTGTTCACTCT This work
Rv_28753 CTGTAGGCTTCTCCGTCGAG This work
Fw_ext_28753 GAGACGAGCCAGACGAAAAC This work
Rv_ext_28753 ATCTGCAGCAGTCGAAGGAT This work
  1. Boldface letters indicate restriction enzyme recognition sites, used for cloning purposes.