Skip to main content

Table 4 Primers used in this study

From: Atypical Listeria innocua strains possess an intact LIPI-3

Primer name Sequence (5′ to 3′)*
PllsAchgA(LI) GGCTGCAG AATCCGCGTTCTTG
PllsAchgB(LI) GAGGTTTTAGGGCTTTGCTC
PhelpFsoe(LI) GAGCAAAGCCCTAAAACCTC GAGATCTGCTGG
PhelpRsoe GATGATTGTGATTTAATATTCAT GGGTTTCACTCTC
PllsAchgC ATGAATATTAAATCACAATCATC
PllsAchgD TGGAATTC CCAGCTCCATTGTCTC
pORI280For CTCGTTCATTATAACCCTC
pORI280Rev CGCTTCCTTTCCCCCCAT
Lin1080_F1 CGGTACGGATTGTGAATGAAGTGG
llsA For CGATTTCACAATGTGATAGGATG
llsA Rev GCACATGCACCTCATAAC
1113for GTTATGAGGTGCATGTGC
1114rev GTCTGGGATATGTAGTCC
1115 rev CACTAGCATGATGTTTATAGGGG
1118rev CATGACAAGCAGTGCCTGTTGATACAGC
1120rev CGTTCCCCCTCCTTTTTAGAGCAG
araC rev CTCTCCTTTTCATTAGCCTGC
actA1-f AATAACAACAGTGAACAAAGC
actA1-r TATCACGTACCCATTTACC
plcB2-f TTGTGATGAATACTTACAAAC
plcB2-r TTTGCTACCATGTCTTCC
actA3-f CGGCGAACCATACAACAT
plcB3-r TGTGGTAATTTGCTGTCG
  1. *Restriction site in bold and SOE overhang italicised.