Skip to main content

Table 3 PCR primers used for the detection of STEC virulence or adherence genes

From: Characterization of Shiga toxin-producing Escherichia coli isolated from healthy pigs in China

Targets Primer Oligonucleotide sequence (5′-3′) Amplicon size (bp) Reference
stx 1 stx 1 - F AAATCGCCATTCGTTGACTACTTCT 370 [61]
  stx 1 -R TGCCATTCTGGCAACTCGCGATGCA
stx 2 stx 2 -F CAGTCGTCACTCACTGGTTTCATCA 283 [61]
  stx 2 -R GGATATTCTCCCCACTCTGACACC
stx 2e stx 2e -F CGGAGTATCGGGGAGAGGC 411 [62]
  stx 2e -R CTTCCTGACACCTTCACAGTAAAGGT
SLT-II GK1 ATGAAGTGTATATTATTTAAATGG 1241 [63]
  GK4 TCAGTCATTATTAAACTGCAC
ehxA ehxA-F GGTGCAGCAGAAAAAGTTGTAG 1551 [64]
  ehxA-R TCTCGCCTGATAGTGTTTGGTA
hlyA hlyA 1-F GACAAAGCACGAAAGATG 2930 [6]
  hlyA 2-R CAACTGCAATAAAGAAGC
astA EAST11a CCATCAACACAGTATATCCGA 111 [65]
  EAST11b GGTCGCGAGTGACGGCTTTGT
irp2 irp2- F AAGGATTCGCTGTTACCGGAC 280 [66]
  irp2- R TCGTCGGGCAGCGTTTCTTCT
fyuA fyuA- F TGATTAACCCCGCGACGGGAA 880 [66]
  fyuA- R CGCAGTAGGCACGATGTTGTA
eae eae-F ACGTTGCAGCATGGGTAACTC 815 [36]
  eae-R GATCGGCAACAGTTTCACCTG
paa M155-F1 ATGAGGAAACATAATGGCAGG 350 [67]
  M155-R1 TCTGGTCAGGTCGTCAATAC
iha iha- F CAGTTCAGTTTCGCATTCACC 1305 [68]
  iha- R GTATGGCTCTGATGCGATG
saa saa- F CGTGATGAACAGGCTATTGC 119 [14]
  saa- R ATGGACATGCCTGTGGCAAC
toxB toxB- F ATACCTACCTGCTCTGGATTGA 602 [69]
  toxB- R TTCTTACCTGATCTGATGCAGC
efa1 efa1- F GAGACTGCCAGAGAAAG 479 [11]
  efa1- R GGTATTGTTGCATGTTCAG
lpfA O157/OI-154 lpfA O157/OI-154-F GCAGGTCACCTACAGGCGGC 525 [14]
  lpfA O157/OI-154-R CTGCGAGTCGGCGTTAGCTG
lpfA O157/OI-141 lpfA O157/OI-141-F CTGCGCATTGCCGTAAC 412 [70]
  lpfA O157/OI-141-R ATTTACAGGCGAGATCGTG
lpfA O113 lpfA O113-F ATGAAGCGTAATATTATAG 573 [9]
  lpfA O113-R TTATTTCTTATATTCGAC
F4(K88) F4-F GCTGCATCTGCTGCATCTGGTATGG 792 [15]
  F4-R CCACTGAGTGCTGGTAGTTACAGCC
F5(K99) F5-F TGCGACTACCAATGCTTCTG 450 [15]
  F5-R TATCCACCATTAGACGGAGC
F6(P987) F6-F TCTGCTCTTAAAGCTACTGG 333 [15]
  F6-R AACTCCACCGTTTGTATCAG
F17 F17-F GGGCTGACAGAGGAGGTGGGGC 411 [15]
  F17-R CCCGGCGACAACTTCATCACCGG
F18 F18-F GTGAAAAGACTAGTGTTTATTTC 510 [15]
  F18-R CTTGTAAGTAACCGCGTAAGC
F41 F41-F GAGGGACTTTCATCTTTTAG 431 [15]
  F41-R AGTCCATTCCATTTATAGGC