Skip to main content

Table 3 PCR primers used for the detection of STEC virulence or adherence genes

From: Characterization of Shiga toxin-producing Escherichia coli isolated from healthy pigs in China

Targets

Primer

Oligonucleotide sequence (5′-3′)

Amplicon size (bp)

Reference

stx 1

stx 1 - F

AAATCGCCATTCGTTGACTACTTCT

370

[61]

 

stx 1 -R

TGCCATTCTGGCAACTCGCGATGCA

stx 2

stx 2 -F

CAGTCGTCACTCACTGGTTTCATCA

283

[61]

 

stx 2 -R

GGATATTCTCCCCACTCTGACACC

stx 2e

stx 2e -F

CGGAGTATCGGGGAGAGGC

411

[62]

 

stx 2e -R

CTTCCTGACACCTTCACAGTAAAGGT

SLT-II

GK1

ATGAAGTGTATATTATTTAAATGG

1241

[63]

 

GK4

TCAGTCATTATTAAACTGCAC

ehxA

ehxA-F

GGTGCAGCAGAAAAAGTTGTAG

1551

[64]

 

ehxA-R

TCTCGCCTGATAGTGTTTGGTA

hlyA

hlyA 1-F

GACAAAGCACGAAAGATG

2930

[6]

 

hlyA 2-R

CAACTGCAATAAAGAAGC

astA

EAST11a

CCATCAACACAGTATATCCGA

111

[65]

 

EAST11b

GGTCGCGAGTGACGGCTTTGT

irp2

irp2- F

AAGGATTCGCTGTTACCGGAC

280

[66]

 

irp2- R

TCGTCGGGCAGCGTTTCTTCT

fyuA

fyuA- F

TGATTAACCCCGCGACGGGAA

880

[66]

 

fyuA- R

CGCAGTAGGCACGATGTTGTA

eae

eae-F

ACGTTGCAGCATGGGTAACTC

815

[36]

 

eae-R

GATCGGCAACAGTTTCACCTG

paa

M155-F1

ATGAGGAAACATAATGGCAGG

350

[67]

 

M155-R1

TCTGGTCAGGTCGTCAATAC

iha

iha- F

CAGTTCAGTTTCGCATTCACC

1305

[68]

 

iha- R

GTATGGCTCTGATGCGATG

saa

saa- F

CGTGATGAACAGGCTATTGC

119

[14]

 

saa- R

ATGGACATGCCTGTGGCAAC

toxB

toxB- F

ATACCTACCTGCTCTGGATTGA

602

[69]

 

toxB- R

TTCTTACCTGATCTGATGCAGC

efa1

efa1- F

GAGACTGCCAGAGAAAG

479

[11]

 

efa1- R

GGTATTGTTGCATGTTCAG

lpfA O157/OI-154

lpfA O157/OI-154-F

GCAGGTCACCTACAGGCGGC

525

[14]

 

lpfA O157/OI-154-R

CTGCGAGTCGGCGTTAGCTG

lpfA O157/OI-141

lpfA O157/OI-141-F

CTGCGCATTGCCGTAAC

412

[70]

 

lpfA O157/OI-141-R

ATTTACAGGCGAGATCGTG

lpfA O113

lpfA O113-F

ATGAAGCGTAATATTATAG

573

[9]

 

lpfA O113-R

TTATTTCTTATATTCGAC

F4(K88)

F4-F

GCTGCATCTGCTGCATCTGGTATGG

792

[15]

 

F4-R

CCACTGAGTGCTGGTAGTTACAGCC

F5(K99)

F5-F

TGCGACTACCAATGCTTCTG

450

[15]

 

F5-R

TATCCACCATTAGACGGAGC

F6(P987)

F6-F

TCTGCTCTTAAAGCTACTGG

333

[15]

 

F6-R

AACTCCACCGTTTGTATCAG

F17

F17-F

GGGCTGACAGAGGAGGTGGGGC

411

[15]

 

F17-R

CCCGGCGACAACTTCATCACCGG

F18

F18-F

GTGAAAAGACTAGTGTTTATTTC

510

[15]

 

F18-R

CTTGTAAGTAACCGCGTAAGC

F41

F41-F

GAGGGACTTTCATCTTTTAG

431

[15]

 

F41-R

AGTCCATTCCATTTATAGGC