Skip to main content

Table 2 qPCR settings and relative transcript abundance

From: Transcriptomic clues to understand the growth of Lactobacillus rhamnosus in cheese

Target gene Primer sequence (5′-3′)a Product size (bp) PCR efficiency Expression ratiob
spxB fwd: TACCGGAAACTGCTTGGTATC 155 1.93 8.97
ulaE fwd: CACTAGCCAAATCAATCGCC 90 2.05 5.78
xfp fwd: CGTGAAGAAGGCGATATC 215 2.01 5.98
  1. aPrimer sets were designed based on the sequences of cDNA-AFLP fragments. Primers for 16S rDNA gene were designed as reported by Giraffa et al. [24].
  2. bTarget gene expression was calculated relative to 16S rDNA as a reference gene using the efficiency-corrected ΔΔC T method [23]. The relative expression ratios in CB compared to MRS are shown.