Skip to main content

Table 1 Primers used for the detection of β-lactamase and aminoglycoside resistant genes

From: A degenerate PCR-based strategy as a means of identifying homologues of aminoglycoside and β-lactam resistance genes in the gut microbiota

Location Primer Sequence 5′-3′ Amplicon Size (bp) Annealing Temp°C Source
β-lactamase genes      
Bla TEM RH605 TTTCGTGTCGCCCTTATTCC 692 60 Bailey et al. (2011) [22]
  RH606 CCGGCTCCAGATTTATCAGC    
  Bla_TEMF TGGGTGCACGAGTGGGTTAC 526 57 Tenover et al. (1994) [23]
  Bla_TEMR TTATCCGCCTCCATCCAGTC    
Bla ROB Bla_ROBF ATCAGCCACACAAGCCACCT 692 62 Tenover et al. (1994) [23]
  Bla_ROBR GTTTGCGATTTGGTATGCGA    
Bla SHV Bla_SHVF CACTCAAGGATGTATTGTG 885 58 Briñas et al. (2002) [24]
  Bla_SHVR TTAGCGTTGCCAGTGCTCG    
Bla OXA Bla_OXAF TTCAAGCCAAAGGCACGATAG 702 64 Briñas et al. (2002) [24]
  Bla_OXAR TCCGAGTTGACTGCCGGGTTG    
Bla CTX-M Bla_CTX-MF CGTTGTAAAACGACGGCCAGTGAATGTGCAGYACCAGTAARGTKATGGC 600 55 Monstein et al. (2009) [25]
  Bla_CTX-MR TGGGTRAARTARGTSACCAGAAYCAGCGG    
AG resistant genes      
aac (3)-I Faac3-1 TTCATCGCGCTTGCTGCYTTYGA 239 58 Heuer et al. (2002) [20]
  Raac3-1 GCCACTGCGGGATCGTCRCCRTA    
aac (3)-II/VI Faac3-2 GCGCACCCCGATGCMTCSATGG 189 58  
  Raac3-2 GGCAACGGCCTCGGCGTARTGSA    
  Facc3-6 GCCCATCCCGACGCATCSATGG    
  Raac3-6 CGCCACCGCTTCGGCATARTGSA    
aac (6′)-II/Ib Faac6 CACAGTCGTACGTTGCKCTBGG 235 58  
  Raac6 CCTGCCTTCTCGTAGCAKCGDAT    
ant (2′)-I Fant TGGGCGATCGATGCACGGCTRG 428 58  
  Rant AAAGCGGCACGCAAGACCTCMAC    
aph (2″)-I Faphc CCCAAGAGTCAACAAGGTGCAGA 527 55  
  Faphd GGCAATGACTGTATTGCATATGA 572 55  
  Raph GAATCTCCAAAATCRATWATKCC    
aac (6′)-Ie-aph (2″)-Ia aac-aphF GAGCAATAAGGGCATACCAAAAATC 505 47 De Fatίma Silva Lopes et al. (2003) [26]
  aac-aphR CCGTGCATTTGTCTTAAAAAACTGG    
  aac6-aph2F CCAAGAGCAATAAGGGCATACC 222 55 Schmitz et al. (1999) [27]
  aac6-aph2R CACACTATCATAACCATCACCG    
  1. AG: aminoglycoside. Type of gene i.e. beta-lactamase or AG given in bold.