Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 3 Nucleotide sequences and specificity of primers employed in the present study

From: Endophytic bacterial community of grapevine leaves influenced by sampling date and phytoplasma infection process

Name Primer sequence (5’-3’) Gene target Taxon target Reference
6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria [19]
338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria [19]
α682F CIAGTGTAGAGGTGAAATT 16S rRNA α-Proteobacteria [18]
908αR CCCCGTCAATTCCTTTGAGTT 16S rRNA α-Proteobacteria [18]
1080γF TCGTCAGCTCGTGTYGTGA 16S rRNA γ-Proteobacteria [18]
γ1202R CGTAAGGGCCATGATG 16S rRNA γ-Proteobacteria [18]
Act920F3 TACGGCCGCAAGGCTA 16S rRNA Actinobacteria [18]
Act1200R TCRTCCCCACCTTCCTCCG 16S rRNA Actinobacteria [18]
Lgc353 GCAGTAGGGAATCTTCCG 16S rRNA Firmicutes [17]
Eub518 ATTACCGCGGCTGCTGG 16S rRNA Firmicutes [17]
MB4 CCGCGTGAGTGATGAAGG 16S rRNA Methylobacterium [21]
MB AGCGCCGTCGGGTAAGA 16S rRNA Methylobacterium [21]
Sph-spt 694f GAGATCGTCCGCTTCCGC spt Sphingomonas [22]
Sph-spt 983r CCGACCGATTTGGAGAAG spt Sphingomonas [22]
Gro1 CTGGAAGACATCGCGATC groEL Burkholderia [20]
Gro2 CGTCGATGATCGTCGTGTT groEL Burkholderia [20]
pagF CACTGGAAACGGTGGCTAAT 16S rRNA Pantoea [23]
pagR CGGCAGTCTCCTTTGAGTTC 16S rRNA Pantoea [23]