Skip to main content

Table 2 DNA sequence of oligonucleotide primer and probes sets used in qPCR screens for target species

From: The Unculturables: targeted isolation of bacterial species associated with canine periodontal health or disease from dental plaque

Assay Target Forward primer Probe Reverse primer
COT005 Peptostreptococcaceae sp. COT-005 CGTAACCGAGGAAATTTTTCGA TGGAATCAGTTACGTTTAGTG GCAGGTTGCCCACGTGTT
COT033 Peptostreptococcus sp. COT-033 CGCGGTTGTGCTTAGTATTGAG CACAACTGAGCGGCGG TCCATGTGTATAGGGCAGGTTACC
COT016 Neisseria animaloris COT-016 AACTGTCCGAAAGGATGGCTAA ATATTCTCTGAGGAGGAAAG CGCAAGGCCCGAAGGT
COT192 Porphyromonas sp. IJD1952 CTTGCCTGATAGAAAGGGATAACC TGAAAGTCGGACTAATAC TCATGCAATAACCCAAGACCATA
COT108 Porphyromonas canoris COT-108 ATGGCGACCGGCGGAT CCCCTCTGACAGGTAAGTTGCATACGC CTTGAAATACCATGCAGYATCTCAAG
COT052 Porphyromonas gulae II COT-052 GTTGAAAGACGGACTAATACC CCTTGCCCGRTCATGCAACCAAGCAAG CATGCCTATCTTACAGCTATAAAT
COT080 Pasteurellaceae [G-2] sp. COT-080 CCTTCGGGTTGTAAAGTTCTT AAGGTATCAACTWTAATAGAGTTGGTAAWDGACGTTAT TGCTGGCACGGAGTTAG
COT084 Odoribacter denticanis COT-084 GGGTAACAGGCGGTAGCAATAC ATGCAATCTACCTTTTACC AAAGAAATGCATCGGGTATTAATCC
COT107 Globicatella sp. COT-107 CGGAAGGAGAACTTGTTCTTTGGA TGTTACTCACCCGTGCGCCACT GGTATTAGCACTCGTTTCCCAGT
COT036 Lachnospiraceae sp. COT-036 GAAGCRCGGGAAGCGGAAGT CGTTACTCACCCGTCCGCCACT CTTTTCCCTCYGTATCATGCGATAC
COT044 Peptococcus sp. COT-044 CGCATAATATCTCTTTATYGCATGATAG CTAAACGACAGCDCTAAGGCCGTCTTT TACTGATCGTCGCCTTGGT
COT064 Filifactor sp. COT-064 GGTGCGTAACGTGTGGGTAA CCTTTGTCATGGGAATAA TTCGGTATTAGCTGCTCTTTCAAG
COT227 Peptostreptococcus sp. COT-227 GCGACTGATTTGATGCTTGC CACCCGTCCGCCGCTCAACTTTCAT AACTTTTCAGTATGTTATCCATGTGTA
COT388 Clostridiales sp. COT-388 GGAAGAAGACTTCGGTCAACGGA CGTTACTCACCCGTCCGCCACT CATTTGGATGCCCATTCGGTATG
COT029 Tissierella sp. COT-029 GAAGAACCTGCCTTTCACATAGGA CGGGATTAATACCAAATGA CCCCAAAAACATGCGATCTC
COT306 Chloroflexi sp. COT-306 GAACGGGTGCAGCGATGT TGTTACTCACCCGTGCGCCACT TAATCTGAGACAGCTTATGCGGT
COT280 Conchiformibius steedae COT-280 GGGATAACTTGCCGAAAGGTAA ACCTCGCGTTATCCGAGCGGCC TAGGCTTTTACCCCACCAACT
Uni B All genus CTCCTACGGGAGGCAGCAG CCAGCAGCCGCGGT GGACTACCAGGGTATCTAATCCTGTT
Uni B   CCTGCGGGAGGCAGC   TACCGGGGTATCTAATCCCGTT
Uni B   CTTCTACGGAAGGCAGCAGTAG   ACTACCAGGGTATCTAGTCCTGTTCG
Uni B   CTTCTACGGGAGGCAGCAG   GACTACCAGGGTGTCTAATCCTGTT
Uni B   CGACGGGAGGCAGCAG   GACTACTAGGGTATCTAATCCTGTTTGC
Uni B   CTACGGGAGGCGGCAG   GACTACCAAGGTATCTAATCCTGTTTGC
Uni B     GACTACCAGGGAATCTAATCCTGTTT
Uni B     GACTATCAGGGTACCTAATCCTGTTTG
Uni B     GACTACCGGAGTATCTAATTCCGTTC
Uni B     GACTACCAGGGTATCTAATCCCGTT
Uni B     CGGGGCATCTAATCCCGT
  1. In order to determine the proportion of the target species 16S rDNA in a sample the UniB assay was used to estimate the total number of 16S rDNA molecules in each reaction.