Figure 1From: The usefulness of biotyping in the determination of selected pathogenicity determinants in Streptococcus mutans 16s rDNA sequencing strategy. A. NC_004350.2 – Streptococcus mutans UA159 genome, SMU_r04 - 16S ribosomal RNA gene (length 1552 bp), grey arrow – forward primer (CGCTGGCGGCGTGCCTAATA), white arrow – reverse primer (TGCAAAGCAGGCGCTCTCCC). B. PCR product (length 1620 bp). C. Average sequencing read length for forward (grey stripe) and reverse (white stripe) primer.Back to article page