Skip to main content

Advertisement

Table 5 PCR primers and probes

From: Exposure to a social stressor disrupts the community structure of the colonic mucosa-associated microbiota

Lactobacillus genus Forward AGCAGTAGGGAATCTTCCA
Reverse CACCGCTACACATGGAG
Lactobacillus reuteri Forward CAGACAATCTTTGATTGTTTAG
Reverse GCTTGTTGGTTTGGGCTCTTC
Parabacteroides distasonis Forward TGCCTATCAGAGGGGGATAAC
Reverse GCAAATATTCCCATGCGGGAT
Porphyromonas-Bacteroides-Prevotella Forward GGTGTCGGCTTAAGTGCCAT
Reverse CGGA(C/T)GTAAGGGCCGTGC
TNF-α Forward CTGTCTACTGAACTTCGGGGTGAT
Reverse GCTCTGGGCCATAGAACTGATG
Probe ATGAGAAGTTCCCAAATGGCCTCCCTC
IL-1β Forward GGCCTCAAAGGAAAGAATCTATACC
Reverse GTATTGCTTGGGATCCACACTCT
Probe ATGAAAGACGGCACACCCACCCTG
iNOS Forward CAGCTGGGCTGTACAAACCTT
Reverse TGAATGTGATGTTTGCTTCGG
  Probe CGGGCAGCCTGTGAGACCTTTGA